ਜਾਣਕਾਰੀ

ਸਰਫੇਸ ਪਲਾਜ਼ਮੋਨ ਰੈਜ਼ੋਨੈਂਸ (SPR) ਅਣੂ ਭਾਰ ਸੀਮਾ ਦਾ ਅਨੁਮਾਨ?

ਸਰਫੇਸ ਪਲਾਜ਼ਮੋਨ ਰੈਜ਼ੋਨੈਂਸ (SPR) ਅਣੂ ਭਾਰ ਸੀਮਾ ਦਾ ਅਨੁਮਾਨ?



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

ਬਸ ਪੁੱਛਦੇ ਹੋਏ, ਕੀ ਅਸੀਂ ਅੰਦਾਜ਼ਾ ਲਗਾ ਸਕਦੇ ਹਾਂ ਕਿ ਸਾਡੀ ਐਸਪੀਆਰ ਪ੍ਰਣਾਲੀ ਸਾਡੇ ਐਲਓਡੀ (ਖੋਜ ਦੀ ਸੀਮਾ) ਅਤੇ ਕਿਸੇ ਹੋਰ ਪ੍ਰੋਟੀਨ ਦੀ ਖੋਜ 'ਤੇ ਸਾਡੀ ਸੰਵੇਦਨਸ਼ੀਲਤਾ ਦੇ ਅਧਾਰ 'ਤੇ ਕਿਵੇਂ ਘੱਟ ਅਣੂ ਭਾਰ (LMW) ਵਿਸ਼ਲੇਸ਼ਣ ਦਾ ਪਤਾ ਲਗਾ ਸਕਦੀ ਹੈ? ਇਸ ਲਈ ਇਸ ਸਮੇਂ ਸਾਡਾ ਵਿਕਸਤ ਸਿਸਟਮ ਲਗਭਗ 5fg/ml LOD ਦੇ ਨਾਲ ਅਲਫ਼ਾ-ਸਿਨੁਕਲੀਨ (14 kDa) ਦਾ ਪਤਾ ਲਗਾ ਸਕਦਾ ਹੈ। ਕੀ ਅਸੀਂ ਅੰਦਾਜ਼ਾ ਲਗਾ ਸਕਦੇ ਹਾਂ ਕਿ ਅਸੀਂ LMW ਦਾ ਪਤਾ ਕਿਵੇਂ ਲਗਾ ਸਕਦੇ ਹਾਂ? ਕੀ ਕੋਈ ਹਵਾਲਾ ਪੇਪਰ ਜਾਂ ਕੁਝ ਹੈ. ਕਿਉਂਕਿ ਜਿੱਥੋਂ ਤੱਕ ਮੇਰੀ ਜਾਣਕਾਰੀ ਹੈ ਅਸੀਂ ਪਹਿਲਾਂ ਪ੍ਰਯੋਗਾਂ ਦੇ ਅਧਾਰ ਤੇ RII ਦੀ ਤਬਦੀਲੀ ਪ੍ਰਾਪਤ ਕਰ ਸਕਦੇ ਹਾਂ। ਪਰ ਇਸ ਸਮੇਂ ਮੇਰਾ ਮਾਮਲਾ ਇਹ ਹੈ ਕਿ ਮੈਂ LMW ਦਾ ਪਤਾ ਲਗਾਉਣ ਲਈ ਸਾਡੇ SPR ਡਿਵਾਈਸਾਂ ਦੀ ਸੀਮਾ ਦੀ ਜਾਂਚ ਕਰਨਾ ਚਾਹੁੰਦਾ ਹਾਂ (ਮੈਂ ਇਹ ਚੁਣ ਰਿਹਾ ਹਾਂ ਕਿ ਇਸ ਸਮੇਂ LMW ਵਿਸ਼ਲੇਸ਼ਕਾਂ ਨੂੰ ਕੀ ਖਰੀਦਣਾ ਹੈ)

ਤੁਹਾਡਾ ਧੰਨਵਾਦ! ਕਿਸੇ ਵੀ ਚਰਚਾ ਜਾਂ ਟਿੱਪਣੀਆਂ ਦੀ ਬਹੁਤ ਪ੍ਰਸ਼ੰਸਾ ਕੀਤੀ ਜਾਂਦੀ ਹੈ


ਸੈੱਲ ਬਾਇਓਲੋਜੀ ਵਿੱਚ ਸਰਫੇਸ ਪਲਾਜ਼ਮੋਨ ਰੈਜ਼ੋਨੈਂਸ ਸੈਂਸਰ: ਬੇਸਿਕਸ ਅਤੇ ਐਪਲੀਕੇਸ਼ਨ

ਸਤਹ ਪਲਾਜ਼ਮੋਨ ਦੇ ਉਤੇਜਨਾ 'ਤੇ ਆਧਾਰਿਤ ਆਪਟੀਕਲ ਸੈਂਸਰ, ਜਿਸ ਨੂੰ ਸਰਫੇਸ ਪਲਾਜ਼ਮੋਨ ਰੈਜ਼ੋਨੈਂਸ (SPR) ਸੈਂਸਰ ਕਿਹਾ ਜਾਂਦਾ ਹੈ, ਰੀਸੈਪਟਰ-ਲਿਗੈਂਡ ਸੰਪਰਕਾਂ ਵਰਗੇ ਮੈਕਰੋਮੋਲੀਕਿਊਲਰ ਪਰਸਪਰ ਕ੍ਰਿਆਵਾਂ ਦੀ ਵਿਭਿੰਨ ਕਿਸਮਾਂ ਨੂੰ ਦਰਸਾਉਣ ਅਤੇ ਮਾਪਣ ਲਈ ਕੇਂਦਰੀ ਵਿਸ਼ਲੇਸ਼ਣਾਤਮਕ ਸਾਧਨ ਬਣ ਗਏ ਹਨ। ਐਪਲੀਕੇਸ਼ਨ ਦੇ ਇਸ ਕਲਾਸੀਕਲ ਖੇਤਰ ਤੋਂ ਇਲਾਵਾ, ਪਿਛਲੇ 15 ਸਾਲਾਂ ਵਿੱਚ, ਲਿਗੈਂਡ/ਸੈੱਲ ਜਾਂ ਹੋਸਟ/ਪੈਥੋਜਨ ਪਰਸਪਰ ਪ੍ਰਭਾਵ, ਸੈੱਲ/ਸੈੱਲ ਸੰਪਰਕ, ਅਤੇ ਸੈਲੂਲਰ ਪ੍ਰਤੀਕ੍ਰਿਆਵਾਂ ਦੀ ਖੋਜ ਅਤੇ ਵਿਸ਼ਲੇਸ਼ਣ ਲਈ ਟੀਚਾ ਰੱਖਣ ਵਾਲੇ SPR ਸੈਂਸਰਾਂ ਦੇ ਵਿਕਾਸ ਨੇ ਕਾਫ਼ੀ ਗਤੀ ਪ੍ਰਾਪਤ ਕੀਤੀ ਹੈ। ਮੈਡੀਕਲ ਡਾਇਗਨੌਸਟਿਕਸ, ਵਾਤਾਵਰਣ ਦੀ ਨਿਗਰਾਨੀ, ਜਾਂ ਜੀਵ-ਵਿਗਿਆਨਕ ਸੁਰੱਖਿਆ ਲਈ ਬਾਇਓਰੀਕੋਗਨੀਸ਼ਨ ਤੱਤ ਵਜੋਂ ਮਹੱਤਵਪੂਰਨ ਪ੍ਰੋਕੈਰੀਓਟਿਕ ਜਾਂ ਯੂਕੇਰੀਓਟਿਕ ਸੈੱਲਾਂ ਨੂੰ ਲਾਗੂ ਕਰਨ ਵਾਲੇ SPR ਸੈਂਸਰਾਂ ਦੀਆਂ ਐਪਲੀਕੇਸ਼ਨਾਂ ਬਾਰੇ ਰਿਪੋਰਟ ਕਰਨ ਵਾਲੇ ਪ੍ਰਕਾਸ਼ਨਾਂ ਦੀ ਗਿਣਤੀ ਲਗਾਤਾਰ ਵਧ ਰਹੀ ਹੈ। ਇਹ ਸਮੀਖਿਆ ਸਤਹ ਪਲਾਜ਼ਮੋਨ ਰੈਜ਼ੋਨੈਂਸ ਦੀ ਤਕਨੀਕ ਅਤੇ ਮਾਪਦੰਡਾਂ ਦੀ ਇੱਕ ਛੋਟੀ ਜਾਣ-ਪਛਾਣ ਦਿੰਦੀ ਹੈ ਜੋ ਮਹੱਤਵਪੂਰਣ ਸੈੱਲ ਸੈਂਸਰਾਂ ਦੇ ਖੇਤਰ ਵਿੱਚ ਇਸਦੀ ਵਰਤੋਂ ਲਈ ਮਹੱਤਵਪੂਰਨ ਹਨ। ਇਸ ਤੋਂ ਇਲਾਵਾ, ਸੈਲੂਲਰ ਪਰਸਪਰ ਕ੍ਰਿਆਵਾਂ ਅਤੇ ਵਾਧੂ- ਅਤੇ ਅੰਦਰੂਨੀ ਉਤੇਜਨਾ ਲਈ ਸੈਲੂਲਰ ਪ੍ਰਤੀਕ੍ਰਿਆਵਾਂ ਦੇ ਵਿਸ਼ਲੇਸ਼ਣ ਵਿੱਚ ਅਜਿਹੇ ਸੈਂਸਰਾਂ ਦੀ ਵਰਤੋਂ ਸੰਬੰਧੀ ਪ੍ਰਕਾਸ਼ਨਾਂ ਦਾ ਸਾਰ ਦਿੱਤਾ ਗਿਆ ਹੈ।

ਇਹ ਸਬਸਕ੍ਰਿਪਸ਼ਨ ਸਮੱਗਰੀ ਦਾ ਪੂਰਵਦਰਸ਼ਨ ਹੈ, ਤੁਹਾਡੀ ਸੰਸਥਾ ਦੁਆਰਾ ਪਹੁੰਚ।


ਸਾਰ

ਵਪਾਰਕ ਤੌਰ 'ਤੇ ਉਪਲਬਧ ਸਤਹ ਪਲਾਜ਼ਮੋਨ ਰੈਜ਼ੋਨੈਂਸ (SPR) ਯੰਤਰਾਂ ਦੀ ਵਰਤੋਂ ਕਰਕੇ ਛੋਟੇ ਅਣੂਆਂ ਦਾ ਸਿੱਧੇ ਤੌਰ 'ਤੇ ਪਤਾ ਲਗਾਉਣਾ ਮੁਸ਼ਕਲ ਹੁੰਦਾ ਹੈ। ਇਹ ਇਸ ਲਈ ਹੈ ਕਿਉਂਕਿ ਘੱਟ ਅਣੂ ਭਾਰ ਵਾਲੇ ਮਿਸ਼ਰਣਾਂ ਵਿੱਚ ਰਿਫ੍ਰੈਕਟਿਵ ਇੰਡੈਕਸ ਵਿੱਚ ਮਾਪਣਯੋਗ ਤਬਦੀਲੀ ਲਿਆਉਣ ਲਈ ਲੋੜੀਂਦਾ ਪੁੰਜ ਨਹੀਂ ਹੁੰਦਾ। ਰਿਫ੍ਰੈਕਟਿਵ ਇੰਡੈਕਸ ਸੰਵੇਦਨਸ਼ੀਲ ਹੁੰਦਾ ਹੈ, ਹਾਲਾਂਕਿ, ਵਿਸ਼ਲੇਸ਼ਕ ਦੇ ਪੁੰਜ ਤੋਂ ਇਲਾਵਾ ਹੋਰ ਵਿਸ਼ੇਸ਼ਤਾਵਾਂ ਲਈ। ਹਾਲ ਹੀ ਵਿੱਚ ਐਸਪੀਆਰ ਦੀ ਵਰਤੋਂ ਕਰਦੇ ਹੋਏ ਸਥਿਰ ਪ੍ਰੋਟੀਨ ਲਈ ਮਹੱਤਵਪੂਰਨ ਸੰਰਚਨਾਤਮਕ ਤਬਦੀਲੀਆਂ ਦਾ ਪਤਾ ਲਗਾਇਆ ਗਿਆ ਹੈ। ਹਾਲਾਂਕਿ, ਸਥਿਰ ਪ੍ਰੋਟੀਨ ਰੀਸੈਪਟਰਾਂ ਲਈ ਘੱਟ ਅਣੂ ਭਾਰ ਲਿਗੈਂਡ ਬਾਈਡਿੰਗ ਦੀ ਖੋਜ ਲਈ ਇਸ ਸੰਪਤੀ ਦਾ ਅਜੇ ਤੱਕ ਸ਼ੋਸ਼ਣ ਨਹੀਂ ਕੀਤਾ ਗਿਆ ਹੈ। ਇੱਥੇ ਅਸੀਂ ਪ੍ਰਦਰਸ਼ਿਤ ਕਰਦੇ ਹਾਂ ਕਿ ਲਿਗੈਂਡ-ਪ੍ਰੇਰਿਤ ਸੰਰਚਨਾਤਮਕ ਤਬਦੀਲੀਆਂ ਦੀ ਵਰਤੋਂ ਛੋਟੇ ਅਣੂਆਂ ਦੇ ਸਥਿਰ ਮਾਲਟੋਜ਼-ਬਾਈਡਿੰਗ ਪ੍ਰੋਟੀਨ ਅਤੇ ਟਿਸ਼ੂ ਟ੍ਰਾਂਸਗਲੂਟਾਮਿਨੇਸ ਦੇ ਬਾਈਡਿੰਗ ਦੀ ਨਿਗਰਾਨੀ ਕਰਨ ਲਈ ਕੀਤੀ ਜਾ ਸਕਦੀ ਹੈ। ਹਾਈਡ੍ਰੋਡਾਇਨਾਮਿਕ ਰੇਡੀਅਸ ਵਿੱਚ ਘਟਣ ਵਾਲੇ ਇੱਕ ਰੀਸੈਪਟਰ ਨਾਲ ਲਿਗੈਂਡ ਬਾਈਡਿੰਗ ਨੇ ਰਿਫ੍ਰੈਕਟਿਵ ਇੰਡੈਕਸ ਵਿੱਚ ਸ਼ੁੱਧ ਕਮੀ ਪ੍ਰਾਪਤ ਕੀਤੀ। ਹਾਈਡ੍ਰੋਡਾਇਨਾਮਿਕ ਰੇਡੀਅਸ ਵਿੱਚ ਵਧਣ ਵਾਲੇ ਰੀਸੈਪਟਰ ਲਈ ਰਿਫ੍ਰੈਕਟਿਵ ਸੂਚਕਾਂਕ ਵਿੱਚ ਇੱਕ ਸ਼ੁੱਧ ਸਕਾਰਾਤਮਕ ਬਦਲਾਅ ਦੇਖਿਆ ਗਿਆ ਸੀ। ਪ੍ਰਤੀਕ੍ਰਿਆਤਮਕ ਸੂਚਕਾਂਕ ਤਬਦੀਲੀਆਂ ਨੂੰ ਸਤ੍ਹਾ 'ਤੇ ਵਿਸ਼ਲੇਸ਼ਕ ਅਣੂ ਪੁੰਜ ਦੇ ਜੋੜ ਦੁਆਰਾ ਸਮਝਾਇਆ ਨਹੀਂ ਜਾ ਸਕਦਾ ਹੈ। ਇਹ SPR ਜਵਾਬ ਖਾਸ ਰੀਸੈਪਟਰ-ਲਿਗੈਂਡ ਪਰਸਪਰ ਕ੍ਰਿਆਵਾਂ ਦਾ ਨਤੀਜਾ ਸਨ, ਜਿਵੇਂ ਕਿ ਪ੍ਰਤੀਕ੍ਰਿਆ ਦੀ ਉਲਟੀਯੋਗਤਾ ਅਤੇ SPR-ਨਿਰਧਾਰਤ ਸੰਤੁਲਨ ਵਿਘਨ ਸਥਿਰਤਾਵਾਂ ਅਤੇ ਰਿਪੋਰਟ ਕੀਤੇ ਗਏ ਵਿਘਨ ਸਥਿਰਾਂਕਾਂ ਵਿਚਕਾਰ ਸਮਾਨਤਾਵਾਂ ਦੁਆਰਾ ਨਿਰਣਾ ਕੀਤਾ ਜਾਂਦਾ ਹੈ। ਇਸ ਤੋਂ ਇਲਾਵਾ, ਇਹ ਤਕਨੀਕ ਛੋਟੇ ਅਣੂਆਂ ਦੇ ਪੈਨਲ ਤੋਂ ਖਾਸ ਲਿਗਾਂਡਾਂ ਦਾ ਪਤਾ ਲਗਾਉਣ ਲਈ ਪ੍ਰਭਾਵਸ਼ਾਲੀ ਸਾਬਤ ਹੋਈ। ਇਸ SPR ਵਿਧੀ ਨੂੰ ਵਿਆਪਕ ਤੌਰ 'ਤੇ ਵਰਤੇ ਜਾਣ ਵਾਲੇ ਅਤੇ ਵਪਾਰਕ ਤੌਰ 'ਤੇ ਉਪਲਬਧ ਸਾਧਨਾਂ ਵਿੱਚ ਕਿਸੇ ਬਦਲਾਅ ਦੀ ਲੋੜ ਨਹੀਂ ਹੈ ਪਰ ਫਿਰ ਵੀ ਕੈਲਸ਼ੀਅਮ ਆਇਨਾਂ (40 Da) ਵਰਗੇ ਬਹੁਤ ਛੋਟੇ ਅਣੂਆਂ ਦੀ ਸਿੱਧੀ ਖੋਜ ਦੀ ਇਜਾਜ਼ਤ ਦਿੱਤੀ ਗਈ ਹੈ। ਘੱਟ ਅਣੂ ਵਜ਼ਨ ਵਿਸ਼ਲੇਸ਼ਕਾਂ ਦਾ ਪਤਾ ਲਗਾਉਣ ਲਈ ਰੀਸੈਪਟਰ ਕਨਫਰਮੇਸ਼ਨ ਦੀ ਵਰਤੋਂ ਛੋਟੇ ਅਣੂ ਡਰੱਗ ਲਾਇਬ੍ਰੇਰੀਆਂ ਦੀ ਉੱਚ-ਥਰੂਪੁੱਟ ਸਕ੍ਰੀਨਿੰਗ ਅਤੇ ਬਾਇਓਸੈਂਸਰਾਂ ਦੇ ਵਿਕਾਸ ਵਿੱਚ ਸੰਭਾਵੀ ਐਪਲੀਕੇਸ਼ਨਾਂ ਹਨ।

ਮੌਜੂਦਾ ਪਤਾ: ਬਾਇਓਕੈਮਿਸਟਰੀ ਵਿਭਾਗ, ਵਿਸਕਾਨਸਿਨ ਮੈਡੀਸਨ ਯੂਨੀਵਰਸਿਟੀ, ਮੈਡੀਸਨ, WI 53706।

ਅਨੁਸਾਰੀ ਲੇਖਕ: (ਈ-ਮੇਲ) [ਈਮੇਲ ਸੁਰੱਖਿਅਤ] (ਫੈਕਸ) 919-597-6400।


ਸਾਰ

ਵਪਾਰਕ ਤੌਰ 'ਤੇ ਉਪਲਬਧ ਸਤਹ ਪਲਾਜ਼ਮੋਨ ਰੈਜ਼ੋਨੈਂਸ (SPR) ਯੰਤਰਾਂ ਦੀ ਵਰਤੋਂ ਕਰਕੇ ਛੋਟੇ ਅਣੂਆਂ ਨੂੰ ਸਿੱਧੇ ਤੌਰ 'ਤੇ ਖੋਜਣਾ ਮੁਸ਼ਕਲ ਹੁੰਦਾ ਹੈ। ਇਹ ਇਸ ਲਈ ਹੈ ਕਿਉਂਕਿ ਘੱਟ ਅਣੂ ਭਾਰ ਵਾਲੇ ਮਿਸ਼ਰਣਾਂ ਵਿੱਚ ਰਿਫ੍ਰੈਕਟਿਵ ਇੰਡੈਕਸ ਵਿੱਚ ਮਾਪਣਯੋਗ ਤਬਦੀਲੀ ਲਿਆਉਣ ਲਈ ਲੋੜੀਂਦਾ ਪੁੰਜ ਨਹੀਂ ਹੁੰਦਾ। ਰਿਫ੍ਰੈਕਟਿਵ ਇੰਡੈਕਸ ਸੰਵੇਦਨਸ਼ੀਲ ਹੁੰਦਾ ਹੈ, ਹਾਲਾਂਕਿ, ਵਿਸ਼ਲੇਸ਼ਕ ਦੇ ਪੁੰਜ ਤੋਂ ਇਲਾਵਾ ਹੋਰ ਵਿਸ਼ੇਸ਼ਤਾਵਾਂ ਲਈ। ਹਾਲ ਹੀ ਵਿੱਚ ਐਸਪੀਆਰ ਦੀ ਵਰਤੋਂ ਕਰਦੇ ਹੋਏ ਸਥਿਰ ਪ੍ਰੋਟੀਨ ਲਈ ਮਹੱਤਵਪੂਰਨ ਸੰਰਚਨਾਤਮਕ ਤਬਦੀਲੀਆਂ ਦਾ ਪਤਾ ਲਗਾਇਆ ਗਿਆ ਹੈ। ਹਾਲਾਂਕਿ, ਸਥਿਰ ਪ੍ਰੋਟੀਨ ਰੀਸੈਪਟਰਾਂ ਲਈ ਘੱਟ ਅਣੂ ਭਾਰ ਲਿਗੈਂਡ ਬਾਈਡਿੰਗ ਦੀ ਖੋਜ ਲਈ ਇਸ ਸੰਪਤੀ ਦਾ ਅਜੇ ਤੱਕ ਸ਼ੋਸ਼ਣ ਨਹੀਂ ਕੀਤਾ ਗਿਆ ਹੈ। ਇੱਥੇ ਅਸੀਂ ਇਹ ਪ੍ਰਦਰਸ਼ਿਤ ਕਰਦੇ ਹਾਂ ਕਿ ਲਿਗੈਂਡ-ਪ੍ਰੇਰਿਤ ਸੰਰਚਨਾਤਮਕ ਤਬਦੀਲੀਆਂ ਦੀ ਵਰਤੋਂ ਛੋਟੇ ਅਣੂਆਂ ਦੇ ਸਥਿਰ ਮਾਲਟੋਜ਼-ਬਾਈਡਿੰਗ ਪ੍ਰੋਟੀਨ ਅਤੇ ਟਿਸ਼ੂ ਟ੍ਰਾਂਸਗਲੂਟਾਮਿਨੇਸ ਦੇ ਬਾਈਡਿੰਗ ਦੀ ਨਿਗਰਾਨੀ ਕਰਨ ਲਈ ਕੀਤੀ ਜਾ ਸਕਦੀ ਹੈ। ਹਾਈਡ੍ਰੋਡਾਇਨਾਮਿਕ ਰੇਡੀਅਸ ਵਿੱਚ ਘਟਣ ਵਾਲੇ ਇੱਕ ਰੀਸੈਪਟਰ ਨਾਲ ਲਿਗੈਂਡ ਬਾਈਡਿੰਗ ਨੇ ਰਿਫ੍ਰੈਕਟਿਵ ਇੰਡੈਕਸ ਵਿੱਚ ਸ਼ੁੱਧ ਕਮੀ ਪ੍ਰਾਪਤ ਕੀਤੀ। ਹਾਈਡ੍ਰੋਡਾਇਨਾਮਿਕ ਰੇਡੀਅਸ ਵਿੱਚ ਵਧਣ ਵਾਲੇ ਰੀਸੈਪਟਰ ਲਈ ਰਿਫ੍ਰੈਕਟਿਵ ਸੂਚਕਾਂਕ ਵਿੱਚ ਇੱਕ ਸ਼ੁੱਧ ਸਕਾਰਾਤਮਕ ਬਦਲਾਅ ਦੇਖਿਆ ਗਿਆ ਸੀ। ਪ੍ਰਤੀਕ੍ਰਿਆਤਮਕ ਸੂਚਕਾਂਕ ਤਬਦੀਲੀਆਂ ਨੂੰ ਸਤ੍ਹਾ 'ਤੇ ਵਿਸ਼ਲੇਸ਼ਕ ਅਣੂ ਪੁੰਜ ਦੇ ਜੋੜ ਦੁਆਰਾ ਸਮਝਾਇਆ ਨਹੀਂ ਜਾ ਸਕਦਾ ਹੈ। ਇਹ SPR ਜਵਾਬ ਖਾਸ ਰੀਸੈਪਟਰ-ਲਿਗੈਂਡ ਪਰਸਪਰ ਕ੍ਰਿਆਵਾਂ ਦਾ ਨਤੀਜਾ ਸਨ, ਜਿਵੇਂ ਕਿ ਪ੍ਰਤੀਕ੍ਰਿਆ ਦੀ ਉਲਟੀਯੋਗਤਾ ਅਤੇ SPR-ਨਿਰਧਾਰਤ ਸੰਤੁਲਨ ਵਿਭਾਜਨ ਸਥਿਰਾਂਕਾਂ ਅਤੇ ਰਿਪੋਰਟ ਕੀਤੇ ਵਿਘਨ ਸਥਿਰਾਂਕਾਂ ਵਿਚਕਾਰ ਸਮਾਨਤਾਵਾਂ ਦੁਆਰਾ ਨਿਰਣਾ ਕੀਤਾ ਜਾਂਦਾ ਹੈ। ਇਸ ਤੋਂ ਇਲਾਵਾ, ਇਹ ਤਕਨੀਕ ਛੋਟੇ ਅਣੂਆਂ ਦੇ ਪੈਨਲ ਤੋਂ ਖਾਸ ਲਿਗਾਂਡਾਂ ਦਾ ਪਤਾ ਲਗਾਉਣ ਲਈ ਪ੍ਰਭਾਵਸ਼ਾਲੀ ਸਾਬਤ ਹੋਈ। ਇਸ SPR ਵਿਧੀ ਨੂੰ ਵਿਆਪਕ ਤੌਰ 'ਤੇ ਵਰਤੇ ਜਾਣ ਵਾਲੇ ਅਤੇ ਵਪਾਰਕ ਤੌਰ 'ਤੇ ਉਪਲਬਧ ਸਾਧਨਾਂ ਵਿੱਚ ਕਿਸੇ ਬਦਲਾਅ ਦੀ ਲੋੜ ਨਹੀਂ ਹੈ ਪਰ ਫਿਰ ਵੀ ਕੈਲਸ਼ੀਅਮ ਆਇਨਾਂ (40 Da) ਵਰਗੇ ਬਹੁਤ ਛੋਟੇ ਅਣੂਆਂ ਦੀ ਸਿੱਧੀ ਖੋਜ ਦੀ ਇਜਾਜ਼ਤ ਦਿੱਤੀ ਗਈ ਹੈ। ਘੱਟ ਅਣੂ ਵਜ਼ਨ ਵਿਸ਼ਲੇਸ਼ਕਾਂ ਦਾ ਪਤਾ ਲਗਾਉਣ ਲਈ ਰੀਸੈਪਟਰ ਕਨਫਰਮੇਸ਼ਨ ਦੀ ਵਰਤੋਂ ਛੋਟੇ ਅਣੂ ਡਰੱਗ ਲਾਇਬ੍ਰੇਰੀਆਂ ਦੀ ਉੱਚ-ਥਰੂਪੁੱਟ ਸਕ੍ਰੀਨਿੰਗ ਅਤੇ ਬਾਇਓਸੈਂਸਰਾਂ ਦੇ ਵਿਕਾਸ ਵਿੱਚ ਸੰਭਾਵੀ ਐਪਲੀਕੇਸ਼ਨ ਹਨ।

ਮੌਜੂਦਾ ਪਤਾ: ਬਾਇਓਕੈਮਿਸਟਰੀ ਵਿਭਾਗ, ਵਿਸਕਾਨਸਿਨ ਮੈਡੀਸਨ ਯੂਨੀਵਰਸਿਟੀ, ਮੈਡੀਸਨ, WI 53706।

ਅਨੁਸਾਰੀ ਲੇਖਕ: (ਈ-ਮੇਲ) [ਈਮੇਲ ਸੁਰੱਖਿਅਤ] (ਫੈਕਸ) 919-597-6400।


ਸਮੱਗਰੀ ਅਤੇ ਢੰਗ

ਨਮੂਨਾ ਇਕੱਠਾ ਕਰਨਾ ਅਤੇ ਲਿਮਫੋਸਾਈਟਸ ਨੂੰ ਅਲੱਗ ਕਰਨਾ

ਇਲਾਜ ਤੋਂ ਬਾਅਦ ਪੀਰੀਅਡੋਨਟਾਈਟਸ ਤੋਂ ਠੀਕ ਹੋਣ ਵਾਲੇ ਦਾਨੀ ਤੋਂ ethylenediaminetetraacetic acid (EDTA) ਦੀਆਂ ਸ਼ੀਸ਼ੀਆਂ (Venoject K2E, Leuven, Belgium) ਵਿੱਚ ਖੂਨ ਇਕੱਠਾ ਕੀਤਾ ਗਿਆ ਸੀ (ਸੈਂਟਰ ਫਾਰ ਓਰਲ ਰੀਹੈਬਲੀਟੇਸ਼ਨ, ਪਬਲਿਕ ਡੈਂਟਲ ਹੈਲਥ ਕੇਅਰ, ਕਾਉਂਟੀ ਕੌਂਸਲ ਆਫ ਓਸਟਰਗੋਟਲੈਂਡ, ਲਿੰਕੋਪਿੰਗ, ਸਵੀਡਨ)। ਪੂਰੇ ਖੂਨ ਨੂੰ 0.9% NaCl ਘੋਲ ਵਿੱਚ 1:1 ਅਨੁਪਾਤ ਵਿੱਚ ਪੇਤਲਾ ਕੀਤਾ ਗਿਆ ਸੀ ਅਤੇ ਧਿਆਨ ਨਾਲ ਦੋ ਫਿਕੋਲ ਟਿਊਬਾਂ (ਥਰਮੋਫਿਸ਼ਰ ਸਾਇੰਟਿਫਿਕ ਇੰਕ., ਸਟਾਕਹੋਮ, ਸਵੀਡਨ) ਵਿੱਚ ਲਿੰਫੋਪਰੇਪ ਘੋਲ (ਐਕਸਿਸ-ਸ਼ੀਲਡ ਪੀ.ਓ.ਸੀ., ਓਸਲੋ, ਨਾਰਵੇ) ਦੇ 6.0 ਮਿਲੀਲੀਟਰ ਉੱਤੇ ਪਰਤਿਆ ਗਿਆ ਸੀ। 1800 'ਤੇ ਗਰੇਡੀਐਂਟ ਸੈਂਟਰੀਫਿਊਗੇਸ਼ਨ g 20 ਮਿੰਟ ਲਈ 20 ਡਿਗਰੀ ਸੈਲਸੀਅਸ 'ਤੇ। ਲਿਮਫੋਸਾਈਟਸ ਦੀ ਇੱਕ ਸਪਸ਼ਟ ਵੱਖਰੀ ਪਰਤ ਨੂੰ ਧਿਆਨ ਨਾਲ ਪਾਈਪ ਕੀਤਾ ਗਿਆ ਸੀ ਅਤੇ ਫਾਸਫੇਟ-ਬਫਰਡ ਖਾਰੇ (PBS pH 7.2 Apoteket AB, ਲਿੰਕੋਪਿੰਗ, ਸਵੀਡਨ) ਨਾਲ ਧੋਤਾ ਗਿਆ ਸੀ। ਐਲ -15 ਮਾਧਿਅਮ ਵਿੱਚ ਸੰਸ਼ੋਧਿਤ ਸੈੱਲ ਜਿਸ ਵਿੱਚ l -ਗਲੂਟਾਮਾਈਨ (ATCC, ਬੋਰਾਸ, ਸਵੀਡਨ), 10% ਭਰੂਣ ਬੋਵਾਈਨ ਸੀਰਮ (FBS ਸਿਗਮਾ-ਐਲਡਰਿਕ, ਸਟਾਕਹੋਮ, ਸਵੀਡਨ) ਨਾਲ ਪੂਰਕ ਅਤੇ ਰਾਤੋ ਰਾਤ 37 °C 'ਤੇ ਪ੍ਰਫੁੱਲਤ ਕੀਤਾ ਗਿਆ।

ਲਿੰਕੋਪਿੰਗ ਵਿੱਚ ਖੇਤਰੀ ਨੈਤਿਕ ਕਮੇਟੀ ਨੇ ਅਧਿਐਨ ਨੂੰ ਮਨਜ਼ੂਰੀ ਦਿੱਤੀ (2010/307-31), ਅਤੇ ਸਾਡੇ ਅਧਿਐਨ ਵਿੱਚ ਭਾਗ ਲੈਣ ਵਾਲੇ ਸਾਰੇ ਮਰੀਜ਼ਾਂ ਨੂੰ ਸਹਿਮਤੀ ਨਾਲ ਸੂਚਿਤ ਕੀਤਾ ਗਿਆ।

ਬੈਕਟੀਰੀਆ ਦੀ ਸੰਸਕ੍ਰਿਤੀ ਅਤੇ ਲਿਮਫੋਸਾਈਟਸ ਦੀ ਉਤੇਜਨਾ

ਪੋਰਫਾਈਰੋਮੋਨਸ ਗਿੰਗੀਵਾਲਿਸ ਜੰਗਲੀ-ਕਿਸਮ ATCC 33277 (ਅਮਰੀਕਨ ਕਿਸਮ ਕਲਚਰ ਕਲੈਕਸ਼ਨ, ਮਾਨਸਾਸ, VA), ਜੰਗਲੀ-ਕਿਸਮ W 50, E8 (W50 ਪ੍ਰਾਪਤ RgpA-ਘਾਟ ਅਤੇ RgpB-ਘਾਟ) ਅਤੇ K1A (W50 ਪ੍ਰਾਪਤ Kgp-ਘਾਟ) (ਕਿਸੇ ਤਰ੍ਹਾਂ ਨਾਲ ਮੁਹੱਈਆ ਕੀਤਾ ਗਿਆ ਹੈ। ਕਰਟਿਸ, ਮੌਲੀਕਿਊਲਰ ਪੈਥੋਜਨੇਸਿਸ ਗਰੁੱਪ, ਕੁਈਨ ਮੈਰੀ, ਲੰਡਨ ਯੂਨੀਵਰਸਿਟੀ, ਯੂ.ਕੇ.), ਜੰਗਲੀ-ਕਿਸਮ 381, ਡੀਪੀਜੀ-3 (381 ਡੈਰੀਵੇਡ ਫਿਮ ਏ-ਡਿਫੀਸ਼ੀਐਂਟ), ਅਤੇ ਕੇਆਰਐਕਸ-178 (381-ਡਰੀਵੇਡ ਐਮਐਫਏ-1-ਡਿਫੀਸ਼ੀਐਂਟ) (ਕਿਰਪਾ ਕਰਕੇ ਪ੍ਰਦਾਨ ਕੀਤਾ ਗਿਆ ਹੈ। ਪ੍ਰੋ. ਆਰ.ਜੇ. ਜੇਨਕੋ, ਮਾਈਕ੍ਰੋਬਾਇਓਲੋਜੀ ਅਤੇ ਇਮਯੂਨੋਲੋਜੀ ਵਿਭਾਗ, ਬਫੇਲੋ ਯੂਨੀਵਰਸਿਟੀ, NY) ਦੁਆਰਾ ਐਨਾਇਰੋਬਿਕ ਹਾਲਤਾਂ (80% N) ਦੇ ਅਧੀਨ ਤੇਜ਼ ਐਨੀਰੋਬ ਬਰੋਥ (29.7 g/L, pH 7.2) ਵਿੱਚ ਉਗਾਇਆ ਗਿਆ ਸੀ।2, 10% CO2, ਅਤੇ 10% ਐੱਚ2) ਇੱਕ ਚੈਂਬਰ ਵਿੱਚ 37 °C 'ਤੇ (ਸੰਕਲਪ 400 ਐਨੇਰੋਬਿਕ ਵਰਕਸਟੇਸ਼ਨ ਰਸਕਿਨ ਟੈਕਨਾਲੋਜੀ ਲਿ., ਲੀਡਜ਼, ਯੂ.ਕੇ.)। ਬੈਕਟੀਰੀਆ ਕ੍ਰੇਬਸ-ਰਿੰਗਰ ਗਲੂਕੋਜ਼ ਬਫਰ (120 mM NaCl, 4.9 mM KCl, 1.2 mM MgSO) ਵਿੱਚ ਧੋਤੇ ਗਏ ਅਤੇ ਮੁੜ-ਸਸਪੈਂਡ ਕੀਤੇ ਗਏ।4, 1.7 mM KH2ਪੀ.ਓ4, 8.3 mM Na2HPO4, ਅਤੇ 10 mM ਗਲੂਕੋਜ਼, pH 7.3)।

ਤਾਪ—ਮਾਰਿਆ ਪੀ. gingivalis 20 ਮਿੰਟ ਲਈ 80 ° C 'ਤੇ ਪ੍ਰਫੁੱਲਤ ਦੁਆਰਾ ਤਿਆਰ ਕੀਤਾ ਗਿਆ ਸੀ। ਕੁੱਲ 10 μL ਗਰਮੀ ਨਾਲ ਮਾਰਿਆ ਮੁਅੱਤਲ ਇੱਕ ਤੇਜ਼ ਐਨੀਰੋਬ ਅਗਰ ਪਲੇਟ 'ਤੇ ਫੈਲਾਇਆ ਗਿਆ ਸੀ ਤਾਂ ਜੋ ਇਹ ਯਕੀਨੀ ਬਣਾਇਆ ਜਾ ਸਕੇ ਕਿ ਬੈਕਟੀਰੀਆ ਮਾਰਿਆ ਗਿਆ ਸੀ ਅਤੇ 5 ਦਿਨਾਂ ਲਈ 37 ° C 'ਤੇ ਪ੍ਰਫੁੱਲਤ ਕੀਤਾ ਗਿਆ ਸੀ। ਤਾਪ—ਮਾਰਿਆ ਪੀ. gingivalis ATCC 33277, 10 9 cfu/mL ਦੀ ਵਰਤੋਂ ਲਿਮਫੋਸਾਈਟਸ ਨੂੰ ਉਤੇਜਿਤ ਕਰਨ ਲਈ ਕੀਤੀ ਗਈ ਸੀ ਅਤੇ 37 °C 'ਤੇ ਪ੍ਰਫੁੱਲਤ ਕੀਤਾ ਗਿਆ ਸੀ। ਤਾਜ਼ੇ ਮਾਧਿਅਮ ਨੂੰ 21 ਦਿਨਾਂ ਤੱਕ ਨਿਯਮਤ ਅੰਤਰਾਲ 'ਤੇ ਪੂਰਕ ਕੀਤਾ ਗਿਆ ਸੀ।

ਲਿਮਫੋਸਾਈਟਸ ਦਾ ਪ੍ਰਵਾਹ ਸਾਇਟੋਮੈਟਰੀ ਵਿਸ਼ਲੇਸ਼ਣ

ਸੈੱਲ ਦੀ ਰਚਨਾ ਦਾ ਅਧਿਐਨ ਕਰਨ ਲਈ ਫਲੋ ਸਾਇਟੋਮੈਟ੍ਰਿਕ ਵਿਸ਼ਲੇਸ਼ਣ ਕੀਤਾ ਗਿਆ ਸੀ। ਸੈੱਲਾਂ ਨੂੰ 300 'ਤੇ ਕੇਂਦਰਿਤ ਕੀਤਾ ਗਿਆ ਸੀ g (Eppendorf Centrifuge 5702R5, ਜਰਮਨੀ) 5 ਮਿੰਟ ਲਈ, ਅਤੇ ਗੋਲੀ ਨੂੰ ਸੁਪਰਨੇਟੈਂਟ ਨੂੰ ਰੱਦ ਕਰਨ 'ਤੇ PBS ਦੇ 1000 μL ਵਿੱਚ ਭੰਗ ਕੀਤਾ ਗਿਆ ਸੀ। ਫਲੋਰੋਕ੍ਰੋਮਜ਼ ਐਲੋਫਾਈਕੋਸਾਈਨਿਨ (ਏਪੀਸੀ), ਫਲੋਰੋਸੀਨ ਆਈਸੋਥੀਓਸਾਇਨੇਟ (ਏਪੀਸੀ), ਫਲੋਰੋਸੀਨ ਆਈਸੋਥੀਓਸਾਇਨੇਟ (ਏਪੀਸੀ), ਅਤੇ CD19, CD3, CD16/56, ਅਤੇ CD45 ਸਤਹ ਮਾਰਕਰ ਦੇ 20 μL ਐਂਟੀਬਾਡੀ ਕਾਕਟੇਲ ਦੇ ਨਾਲ ਨਮੂਨੇ ਦੇ 100 μL ਨੂੰ ਮਿਲਾ ਕੇ ਨਿਰਧਾਰਤ ਕੀਤਾ ਗਿਆ ਸੀ। ਪੇਰੀਡੀਨਿਨ ਕਲੋਰੋਫਿਲ ਪ੍ਰੋਟੀਨ ਕੰਪਲੈਕਸ (PerCP) (BD ਬਾਇਓਸਾਇੰਸ, ਸਟਾਕਹੋਮ, ਸਵੀਡਨ) ਅਤੇ ਹਨੇਰੇ ਵਿੱਚ 15 ਮਿੰਟ ਲਈ ਪ੍ਰਫੁੱਲਤ ਕੀਤਾ ਗਿਆ। ਲਾਲ ਰਕਤਾਣੂਆਂ ਨੂੰ 450 μL ਲਾਇਸਿੰਗ ਘੋਲ (2% ਭਰੂਣ ਵੱਛੇ ਦੇ ਸੀਰਮ (ਐਫਸੀਐਸ ਸਿਗਮਾ-ਐਲਡਰਿਕ, ਸਟਾਕਹੋਮ, ਸਵੀਡਨ), ਪੀਬੀਐਸ pH 7.4 ਵਿੱਚ 0.1% ਸੋਡੀਅਮ ਅਜ਼ਾਈਡ ਘੋਲ) ਜੋੜ ਕੇ ਲਾਈਜ਼ ਕੀਤਾ ਗਿਆ ਸੀ। ਪ੍ਰਫੁੱਲਤ ਹੋਣ ਦੇ 15 ਮਿੰਟ ਬਾਅਦ, ਸੈੱਲਾਂ ਦਾ BD FACS Canto (BD Biosciences, Stockholm, Sweden) ਵਿੱਚ ਵਿਸ਼ਲੇਸ਼ਣ ਕੀਤਾ ਗਿਆ। ਨਤੀਜਿਆਂ ਨੂੰ ਵਿਸ਼ਲੇਸ਼ਣ ਲਈ CD45+ ਲਿਮਫੋਸਾਈਟ ਸੈੱਲਾਂ ਨੂੰ ਜੋੜ ਕੇ ਲਘੂਗਣਕ ਪੈਮਾਨੇ 'ਤੇ ਤਿਆਰ ਕੀਤਾ ਗਿਆ ਸੀ। ਸੈੱਲਾਂ ਦਾ ਵਿਸ਼ਲੇਸ਼ਣ ਬੈਕਟੀਰੀਆ ਦੇ ਨਾਲ ਉਤੇਜਨਾ ਤੋਂ 1 ਹਫ਼ਤੇ ਬਾਅਦ ਕੀਤਾ ਗਿਆ ਸੀ, ਜਦੋਂ ਕਿ ਅਣਉਚਿਤ ਸੈੱਲਾਂ ਦਾ ਵਿਸ਼ਲੇਸ਼ਣ 3 ਦਿਨਾਂ ਬਾਅਦ ਕੀਤਾ ਗਿਆ ਸੀ। 3 ਦਿਨਾਂ ਬਾਅਦ ਅਣਉਚਿਤ ਲਿਮਫੋਸਾਈਟਸ ਵਿੱਚ ਇੱਕ ਸਰਗਰਮ ਏਜੰਟ ਦੀ ਅਣਹੋਂਦ ਕਾਰਨ ਹੋਰ ਵਿਸ਼ਲੇਸ਼ਣ ਲਈ ਲੋੜੀਂਦੀ ਸੈੱਲ ਗਿਣਤੀ ਨਹੀਂ ਸੀ। ਇਸ ਲਈ, ਲਿਮਫੋਸਾਈਟਸ ਨੂੰ ਉਸੇ ਮਰੀਜ਼ ਦੇ ਖੂਨ ਤੋਂ ਅਲੱਗ ਕੀਤਾ ਗਿਆ ਸੀ ਅਤੇ ਸੰਸਕ੍ਰਿਤ ਕੀਤਾ ਗਿਆ ਸੀ, ਜਿਵੇਂ ਕਿ ਪਹਿਲਾਂ ਦੱਸਿਆ ਗਿਆ ਸੀ, ਪ੍ਰਵਾਹ ਸਾਇਟੋਮੈਟਰੀ ਵਿਸ਼ਲੇਸ਼ਣ ਤੋਂ ਤਿੰਨ ਦਿਨ ਪਹਿਲਾਂ.

ਇਮਯੂਨੋਫਲੋਰੋਸੈਂਟ ਸਟੈਨਿੰਗ ਅਤੇ ਕਨਫੋਕਲ ਮਾਈਕ੍ਰੋਸਕੋਪੀ

ਪ੍ਰਫੁੱਲਤ ਹੋਣ ਦੇ 2 ਅਤੇ 3 ਹਫ਼ਤਿਆਂ ਦੁਆਰਾ ਪ੍ਰੇਰਿਤ ਸੈੱਲ ਮੁਅੱਤਲ 170 'ਤੇ ਸੈਂਟਰਿਫਿਊਜ ਕੀਤੇ ਗਏ ਸਨ g, ਅਤੇ ਗੋਲੀ ਨੂੰ 10% FBS ਵਾਲੇ ਤਾਜ਼ੇ l -15 ਮਾਧਿਅਮ ਦੇ 2 mL ਵਿੱਚ ਭੰਗ ਕੀਤਾ ਗਿਆ ਸੀ। 5 × 10 5 ਸੈੱਲ/mL ਮੁਅੱਤਲ ਦੇ ਕੁੱਲ 200 μL ਨੂੰ ਫਿਰ 6 ਮਿੰਟ ਲਈ 600 rpm 'ਤੇ ਸਾਇਟੋਸੈਂਟਰੀਫਿਊਜ ਕੀਤਾ ਗਿਆ ਸੀ। ਪੈਰਾਫਾਰਮਲਡੀਹਾਈਡ (4%) ਕਮਰੇ ਦੇ ਤਾਪਮਾਨ 'ਤੇ 2 ਘੰਟੇ ਲਈ ਸੈੱਲਾਂ ਨੂੰ ਠੀਕ ਕਰਨ ਲਈ ਵਰਤਿਆ ਗਿਆ ਸੀ। ਸਥਿਰ ਸੈੱਲਾਂ ਨੂੰ 5 ਮਿੰਟ ਦੇ ਪ੍ਰਫੁੱਲਤ ਹੋਣ ਦੇ ਅੰਤਰਾਲਾਂ 'ਤੇ PBS ਨਾਲ ਚਾਰ ਵਾਰ ਧੋਤਾ ਗਿਆ, ਕਮਰੇ ਦੇ ਤਾਪਮਾਨ 'ਤੇ 1 ਘੰਟੇ ਲਈ 5% FBS ਦੀ ਵਰਤੋਂ ਕਰਕੇ ਬਲੌਕ ਕੀਤਾ ਗਿਆ, ਅਤੇ ਫਿਰ ਉਸੇ ਪ੍ਰੋਟੋਕੋਲ ਦੀ ਵਰਤੋਂ ਕਰਕੇ ਦੁਬਾਰਾ ਧੋਤਾ ਗਿਆ। ਸੈੱਲਾਂ ਨੂੰ 4 ਡਿਗਰੀ ਸੈਲਸੀਅਸ 'ਤੇ ਰਾਤੋ-ਰਾਤ ਮਨੁੱਖੀ-ਵਿਰੋਧੀ CD38 ਐਂਟੀਬਾਡੀਜ਼ (ਬੀਡੀ ਬਾਇਓਸਾਇੰਸ, ਸਟਾਕਹੋਮ, ਸਵੀਡਨ 1:100 ਪਤਲਾ) ਨਾਲ ਪ੍ਰਫੁੱਲਤ ਕੀਤਾ ਗਿਆ ਸੀ। ਸੈੱਲਾਂ ਨੂੰ ਪਹਿਲਾਂ ਵਾਂਗ ਪੀਬੀਐਸ ਨਾਲ ਧੋਤਾ ਗਿਆ ਸੀ ਅਤੇ ਫਿਰ ਕਮਰੇ ਦੇ ਤਾਪਮਾਨ 'ਤੇ 2 ਘੰਟੇ ਲਈ ਫਲੋਰੇਸੀਨ ਆਈਸੋਥਿਓਸਾਈਨੇਟ ਕਨਜੁਗੇਟਿਡ-ਬੱਕਰੀ ਵਿਰੋਧੀ ਮਾਊਸ ਐਂਟੀਬਾਡੀਜ਼ ਨਾਲ ਪ੍ਰਫੁੱਲਤ ਕੀਤਾ ਗਿਆ ਸੀ। ਸੈੱਲਾਂ ਨੂੰ PBS ਨਾਲ ਚਾਰ ਵਾਰ ਧੋਤਾ ਗਿਆ ਅਤੇ ਫਿਰ 3 ਮਿੰਟ ਲਈ 4ʹ,6-diamidino-2-phenylindole (DAPI) (ਸਿਗਮਾ-ਐਲਡਰਿਕ, ਸਟਾਕਹੋਮ, ਸਵੀਡਨ) ਦੇ 1:200 ਪਤਲੇਪਣ ਨਾਲ ਪ੍ਰਤੀਰੋਧਿਤ ਕੀਤਾ ਗਿਆ। ਚਾਰ ਵਾਰ ਧੋਣ ਤੋਂ ਬਾਅਦ, ਸੈੱਲਾਂ ਦਾ ਇੱਕ ਲੇਜ਼ਰ-ਕੈਪਚਰ ਮਾਈਕ੍ਰੋਡਿਸੈਕਸ਼ਨ (ਐਲਸੀਐਮ) ਜ਼ੀਸ ਕਨਫੋਕਲ ਮਾਈਕ੍ਰੋਸਕੋਪ (ਡਿਪਾਰਟਮੈਂਟ ਆਫ਼ ਪੈਥੋਲੋਜੀ, ਲਿੰਕੋਪਿੰਗ ਯੂਨੀਵਰਸਿਟੀ, ਸਵੀਡਨ) ਵਿੱਚ ਵਿਸ਼ਲੇਸ਼ਣ ਕੀਤਾ ਗਿਆ ਸੀ।

ਐਂਟੀਬਾਡੀ ਰਿਕਵਰੀ

3 ਹਫ਼ਤਿਆਂ ਬਾਅਦ, ਕਲਚਰ ਮਾਧਿਅਮ ਨੂੰ ਨਿਰਜੀਵ 15 ਮਿ.ਲੀ. ਸੈਂਟਰਿਫਿਊਜ ਟਿਊਬਾਂ (ਗ੍ਰੇਨਰ ਬਾਇਓ-ਵਨ, ਜਰਮਨੀ) ਵਿੱਚ ਤਬਦੀਲ ਕੀਤਾ ਗਿਆ ਅਤੇ 3500 'ਤੇ ਸੈਂਟਰਿਫਿਊਜ ਕੀਤਾ ਗਿਆ। g ਸੈੱਲਾਂ ਨੂੰ ਗੋਲੀ ਮਾਰਨ ਲਈ 10 ਮਿੰਟ ਲਈ। ਸੁਪਰਨੇਟੈਂਟ ਨੂੰ 0.45 µm ਨਿਰਜੀਵ ਫਿਲਟਰਾਂ (ਥਰਮੋਫਿਸ਼ਰ ਸਾਇੰਟਿਫਿਕ, ਸਟਾਕਹੋਮ, ਸਵੀਡਨ) ਦੀ ਵਰਤੋਂ ਕਰਕੇ ਫਿਲਟਰ ਕੀਤਾ ਗਿਆ ਸੀ ਅਤੇ 3500 'ਤੇ 100 ਕੇਡੀਏ ਐਮੀਕਨ ਮਾਈਕ੍ਰੋਕਨ ਕਟੌਫ ਫਿਲਟਰਾਂ (ਮਿਲੀਪੋਰ, ਮੋਲਸ਼ੇਮ, ਫਰਾਂਸ) ਦੀ ਵਰਤੋਂ ਕਰਕੇ ਸੈਂਟਰਿਫਿਊਜ ਕੀਤਾ ਗਿਆ ਸੀ। g 60 ਮਿੰਟ ਲਈ ਲਈ ਐਂਟੀਬਾਡੀਜ਼ ਰੱਖਣ ਵਾਲੇ ਸੁਪਰਨੇਟੈਂਟ ਪੀ. gingivalis ਅਣੂ ਦੇ ਭਾਰ >100 KDa ਦੇ ਨਾਲ ਇਕੱਠਾ ਕੀਤਾ ਗਿਆ ਸੀ, ਅਤੇ ਨਿਰਜੀਵ ਨੂੰ 0.2-µm ਨਿਰਜੀਵ ਫਿਲਟਰਾਂ (ਥਰਮੋਫਿਸ਼ਰ ਸਾਇੰਟਿਫਿਕ, ਸਟਾਕਹੋਮ, ਸਵੀਡਨ) ਨਾਲ ਫਿਲਟਰ ਕੀਤਾ ਗਿਆ ਸੀ ਤਾਂ ਜੋ −50 °C 'ਤੇ ਸਟੋਰ ਕੀਤਾ ਜਾ ਸਕੇ।

ਸੋਡੀਅਮਡੋਡੇਸੀਲ ਸਲਫੇਟ ਪੋਲੀਐਕਰੀਲਾਮਾਈਡ ਜੈੱਲ ਇਲੈਕਟ੍ਰੋਫੋਰੇਸਿਸ

ਸਟੈਂਡਰਡ ਸੋਡੀਅਮਡੋਡੇਸਾਈਲ ਸਲਫੇਟ ਪੋਲੀਐਕਰੀਲਾਮਾਈਡ ਜੈੱਲ ਇਲੈਕਟ੍ਰੋਫੋਰੇਸਿਸ ਨੂੰ ਐਂਟੀਜੇਨ-ਐਂਟੀਬਾਡੀ ਪਰਸਪਰ ਪ੍ਰਭਾਵ ਨੂੰ ਐਂਟੀਜੇਨਜ਼ ਨੂੰ ਐਂਟੀਬਾਡੀਜ਼ ਦੀ ਵਿਸ਼ੇਸ਼ਤਾ ਦਿਖਾਉਣ ਲਈ ਇੱਕ ਵਿਕਲਪਿਕ ਢੰਗ ਵਜੋਂ ਕਲਪਨਾ ਕਰਨ ਲਈ ਕੀਤਾ ਗਿਆ ਸੀ। ਤਾਪ—ਮਾਰਿਆ ਪੀ. gingivalis, ਜਿਸਦੀ ਵਰਤੋਂ ਮੇਜ਼ਬਾਨ ਲਿਮਫੋਸਾਈਟਸ ਨੂੰ ਉਤੇਜਿਤ ਕਰਨ ਲਈ ਕੀਤੀ ਜਾਂਦੀ ਸੀ, ਨੂੰ ਦੋਨਾਂ ਵਿਰੋਧੀ-ਪੀ. gingivalis ਵਿਟਰੋ ਅਤੇ ਐਂਟੀਬਾਡੀਜ਼ ਵਿੱਚ ਪੈਦਾ ਹੁੰਦੇ ਹਨਐਸਚੇਰੀਚੀਆ ਕੋਲੀ ਐਂਟੀਬਾਡੀਜ਼ (ਸਵੀਡ ਡਾਇਗਨੌਸਟਿਕਸ, ਸਟਾਕਹੋਮ, ਸਵੀਡਨ)।

ਸਾਰੇ ਤਿਆਰ ਕੀਤੇ ਨਮੂਨਿਆਂ ਨੂੰ ਪੀਬੀਐਸ (ਪੀਐਚ 7.4, ਸਿਗਮਾ-ਐਲਡਰਿਕ, ਸਟਾਕਹੋਮ, ਸਵੀਡਨ) ਦੇ ਨਾਲ 1:4 ਅਨੁਪਾਤ 'ਤੇ ਪੇਤਲਾ ਕੀਤਾ ਗਿਆ ਸੀ ਅਤੇ 3450 'ਤੇ ਸੈਂਟਰਿਫਿਊਜ ਕੀਤਾ ਗਿਆ ਸੀ। g ਪ੍ਰਫੁੱਲਤ ਹੋਣ ਦੇ 24 ਘੰਟੇ ਬਾਅਦ 10 ਮਿੰਟ ਲਈ। ਸੁਪਰਨੇਟੈਂਟਸ ਨੂੰ 100 KDa ਸੈਂਟਰਿਫਿਊਜ ਫਿਲਟਰਾਂ (ਮਿਲੀਪੋਰ, ਸਟਾਕਹੋਮ, ਸਵੀਡਨ) ਵਿੱਚ ਸੈਂਟਰਿਫਿਊਜ ਕੀਤਾ ਗਿਆ ਸੀ ਅਤੇ 5 ਮਿੰਟ ਲਈ ਲੈਮਮਲੀ ਬਫਰ ਦੀ ਬਰਾਬਰ ਮਾਤਰਾ ਨਾਲ ਗਰਮ ਕੀਤਾ ਗਿਆ ਸੀ। ਨਮੂਨੇ ਸੋਡੀਅਮਡੋਡੇਸਾਈਲ ਸਲਫੇਟ ਪੋਲੀਐਕਰੀਲਾਮਾਈਡ ਜੈੱਲ ਇਲੈਕਟ੍ਰੋਫੋਰੇਸਿਸ ਟੀਜੀਐਕਸ ਪ੍ਰੀਕਾਸਟ ਜੈੱਲ (ਬਾਇਓ-ਰੈਡ, ਸਟਾਕਹੋਮ, ਸਵੀਡਨ) ਵਿੱਚ ਚਲਾਏ ਗਏ ਸਨ।

IgG ਸਬ-ਕਲਾਸ ਪਰਖ

IgG ਸਬਕਲਾਸ ਵਿਸ਼ਲੇਸ਼ਣ ਇੱਕ ELISA ਕਿੱਟ ਦੀ ਵਰਤੋਂ ਕਰਕੇ ਵਿਟਰੋ ਵਿੱਚ ਪੈਦਾ ਕੀਤੇ ਐਂਟੀਬਾਡੀਜ਼ 'ਤੇ ਕੀਤਾ ਗਿਆ ਸੀ। ਪ੍ਰੀ-ਕੋਟੇਡ ELISA ਪਲੇਟਾਂ ਅਤੇ ਰੀਐਜੈਂਟ ਨਿਰਮਾਤਾ ਦੀਆਂ ਹਦਾਇਤਾਂ ਅਨੁਸਾਰ ਤਿਆਰ ਕੀਤੇ ਗਏ ਸਨ। ਵਿਟਰੋ ਐਂਟੀਬਾਡੀਜ਼ ਦੇ ਵਿਰੁੱਧ ਪੈਦਾ ਹੁੰਦੇ ਹਨ ਪੀ. gingivalis 1:4 ਅਨੁਪਾਤ ਵਿੱਚ ELISA diluent ਨਾਲ ਪਤਲਾ ਕੀਤਾ ਗਿਆ ਸੀ। Peroxidase ਐਂਟੀ-ਹਿਊਮਨ IgG ਘੋਲ ਨੂੰ ਸੈਕੰਡਰੀ ਐਂਟੀਬਾਡੀ ਵਜੋਂ ਵਰਤਿਆ ਗਿਆ ਸੀ, ਅਤੇ 3,3ʹ,5,5ʹ-tetramethylbenzidine ਸਬਸਟਰੇਟ ਘੋਲ ਕ੍ਰੋਮੋਜਨ ਪ੍ਰਤੀਕ੍ਰਿਆ ਲਈ ਵਰਤਿਆ ਗਿਆ ਸੀ। ਨਤੀਜੇ ਇੱਕ ELISA ਮਾਈਕ੍ਰੋਰੀਡਰ (ਮਾਹਰ 96 ELISA ਰੀਡਰ, GmBH, ਆਸਟਰੀਆ) ਵਿੱਚ ਸਟਾਪ ਹੱਲ ਜੋੜਨ ਤੋਂ ਬਾਅਦ ਇੱਕ ਘੰਟੇ ਦੇ ਅੰਦਰ 450 nm 'ਤੇ ਪੜ੍ਹੇ ਗਏ ਸਨ। ਨਿਰਮਾਤਾ ਦੁਆਰਾ ਪ੍ਰਦਾਨ ਕੀਤੇ ਮਨੁੱਖੀ ਸੀਰਮ ਨੂੰ ਨਿਯੰਤਰਣ ਦੇ ਤੌਰ ਤੇ ਵਰਤਿਆ ਗਿਆ ਸੀ, ਅਤੇ ਗਾੜ੍ਹਾਪਣ ਮਿਆਰਾਂ ਤੋਂ ਗਿਣਿਆ ਗਿਆ ਸੀ।

ਸਤਹ ਪਲਾਜ਼ਮੋਨ ਗੂੰਜ

ਵਿਰੋਧੀ-ਪੀ. gingivalis ਅਮੀਨ ਕਪਲਿੰਗ ਵਿਧੀ ਦੀ ਵਰਤੋਂ ਕਰਦੇ ਹੋਏ ਵਿਸ਼ੇਸ਼ ਐਂਟੀਜੇਨ-ਐਂਟੀਬਾਡੀ ਪਰਸਪਰ ਕ੍ਰਿਆਵਾਂ ਦੀ ਜਾਂਚ ਕਰਨ ਲਈ ਇੱਕ Biacore® 1000 (GE Healthcare Ltd, Sweden) ਦੀ ਇੱਕ CM 5 ਸੈਂਸਰ ਚਿੱਪ 'ਤੇ ਐਂਟੀਬਾਡੀਜ਼ ਨੂੰ ਸਥਿਰ ਕੀਤਾ ਗਿਆ ਸੀ। ਸਥਿਰਤਾ ਤਿੰਨ ਪੜਾਵਾਂ ਵਿੱਚ ਕੀਤੀ ਗਈ ਸੀ। ਪਹਿਲਾਂ, ਚਿੱਪ 'ਤੇ ਕਾਰਬੋਕਸੀਮੇਥਾਈਲੇਟਿਡ ਡੇਕਸਟ੍ਰਾਨ-ਕੋਟੇਡ ਚੈਨਲ ਸਤਹ ਨੂੰ ਟੀਕਾ ਲਗਾ ਕੇ ਕਿਰਿਆਸ਼ੀਲ ਕੀਤਾ ਗਿਆ ਸੀ। ਐਨ- ਹਾਈਡ੍ਰੋਕਸਾਈਸੁਸੀਨਾਈਮਾਈਡ ਅਤੇ ਐਨ-ਈਥਾਈਲ-ਨਡੀਮੇਥਾਈਲ ਐਮੀਨੋਪ੍ਰੋਪਾਈਲ ਕਾਰਬੋਨਾਮਾਈਡ ਹਾਈਡ੍ਰੋਕਲੋਰਾਈਡ (GE ਹੈਲਥਕੇਅਰ ਲਿਮਟਿਡ, ਸਵੀਡਨ) ਮਿਸ਼ਰਣ (1:1 ਅਨੁਪਾਤ)। ਵਿਰੋਧੀ-ਪੀ. gingivalis ਐਂਟੀਬਾਡੀਜ਼ ਨੂੰ ਐਸੀਟੇਟ (ਪੀਐਚ 4.5) ਨਾਲ ਪੇਤਲਾ ਕੀਤਾ ਗਿਆ ਸੀ, ਜੋ ਟੀਕੇ 'ਤੇ ਚਿੱਪ ਦੀ ਕਿਰਿਆਸ਼ੀਲ ਸਤਹ ਨਾਲ ਜੁੜਦਾ ਹੈ। ਅੰਤ ਵਿੱਚ, ਸੈਂਸਰ ਸਤਹ ਨੂੰ 70 μL ਐਥੇਨੋਲਾਮਾਈਨ (GE ਹੈਲਥਕੇਅਰ ਲਿਮਟਿਡ, ਸਵੀਡਨ) ਦਾ ਟੀਕਾ ਲਗਾ ਕੇ ਅਯੋਗ ਕਰ ਦਿੱਤਾ ਗਿਆ ਸੀ, ਜਿਸ ਨਾਲ ਸੈਂਸਰ ਸਤਹ 'ਤੇ ਹੋਰ ਕਣਾਂ ਨੂੰ ਬੰਨ੍ਹਣ ਤੋਂ ਰੋਕਿਆ ਗਿਆ ਸੀ।

ਸਥਿਰ ਐਂਟੀਬਾਡੀਜ਼ ਦੀ ਜਾਂਚ ਸਕਾਰਾਤਮਕ ਅਤੇ ਨਕਾਰਾਤਮਕ ਨਿਯੰਤਰਣ ਦੁਆਰਾ ਕੀਤੀ ਗਈ ਸੀ। ਮਨੁੱਖੀ-ਵਿਰੋਧੀ IgG (ਸਿਗਮਾ-ਐਲਡਰਿਕ, ਸੇਂਟ ਲੁਈਸ, MO) ਅਤੇ ਗਰਮੀ ਨਾਲ ਮਾਰਿਆ ਗਿਆ ਪੀ. gingivalis ਪਹਿਲਾਂ ਲਿਮਫੋਸਾਈਟਸ ਨੂੰ ਉਤੇਜਿਤ ਕਰਨ ਲਈ ਵਰਤੇ ਜਾਂਦੇ ਸਨ ਜੋ ਸਕਾਰਾਤਮਕ ਨਿਯੰਤਰਣ ਵਜੋਂ ਵਰਤੇ ਜਾਂਦੇ ਸਨ। ਕਈ ਏਟੀਸੀਸੀ ਬੈਕਟੀਰੀਆ ਦੇ ਤਣਾਅ (ਸੀਸੀਯੂਜੀ, ਗੋਟੇਨਬਰਗ, ਸਵੀਡਨ) ਅਤੇ ਐਂਟੀ-ਗਿੰਨੀ ਪਿਗ ਆਈਜੀਜੀ (ਸਿਗਮਾ-ਐਲਡਰਚ) ਨਕਾਰਾਤਮਕ ਨਿਯੰਤਰਣ ਵਜੋਂ ਵਰਤੇ ਗਏ ਸਨ। SPR ਨਾਲ ਪ੍ਰਾਪਤ ਜਵਾਬ ਨੂੰ Bia-ਮੁਲਾਂਕਣ ਸੌਫਟਵੇਅਰ (GE Healthcare Ltd., Sweden) ਦੀ ਵਰਤੋਂ ਕਰਕੇ RUs ਵਿੱਚ ਮਾਪਿਆ ਗਿਆ ਸੀ।

ਦੀ ਖੋਜ ਪੋਰਫਾਇਰੋਮੋਨਸ ਗਿੰਗੀਵਾਲਿਸ ਵਿਟਰੋ ਵਿੱਚ ਅਤੇ ਕਲੀਨਿਕਲ ਨਮੂਨਿਆਂ ਵਿੱਚ

ਸਿਹਤਮੰਦ ਖੂਨਦਾਨੀਆਂ ਤੋਂ ਪਲਾਜ਼ਮਾ ਦੇ ਨਮੂਨੇ ਇਕੱਠੇ ਕੀਤੇ ਗਏ ਸਨ ਅਤੇ 10 8 cfu/mL ਜੰਗਲੀ ਕਿਸਮ ਦੇ ਅਤੇ ਫਿਮਬਰੀਆ ਮਿਊਟੈਂਟਸ ਨਾਲ ਪ੍ਰਫੁੱਲਤ ਕੀਤੇ ਗਏ ਸਨ। ਪੀ. gingivalis. ਨਮੂਨਿਆਂ ਨੂੰ ਪੀਬੀਐਸ 7.4 (ਸਿਗਮਾ-ਐਲਡਰਿਕ, ਸਟਾਕਹੋਮ, ਸਵੀਡਨ) ਵਿੱਚ 1:20 ਪਤਲਾ ਕੀਤਾ ਗਿਆ ਸੀ, ਅਤੇ ਇਹਨਾਂ ਦੇ ਇੱਕ ਸਮੂਹ ਨੂੰ ਐਂਟੀ-ਨਾਲ ਪ੍ਰਫੁੱਲਤ ਕੀਤਾ ਗਿਆ ਸੀ।ਪੀ. gingivalis ਰਾਤੋ ਰਾਤ ਐਂਟੀਬਾਡੀਜ਼. ਨਮੂਨੇ, ਐਂਟੀਬਾਡੀ ਇਨਕਿਊਬੇਸ਼ਨ ਦੇ ਨਾਲ ਅਤੇ ਬਿਨਾਂ, ਐਂਟੀ-ਨਾਲ ਸਥਿਰ ਚਿੱਪ 'ਤੇ ਚਲਾਏ ਗਏ ਸਨ।ਪੀ. gingivalis 5 μL/ਮਿੰਟ ਦੀ ਵਹਾਅ ਦਰ 'ਤੇ ਐਂਟੀਬਾਡੀਜ਼।

ਮਰੀਜ਼ਾਂ ਤੋਂ ਗਿੰਗੀਵਲ ਕ੍ਰੇਵੀਕੂਲਰ ਤਰਲ (ਜੀਸੀਐਫ) ਦੇ ਨਮੂਨੇ ਇਕੱਠੇ ਕੀਤੇ ਗਏ ਸਨ (n = 30) ਪੀਰੀਓਡੌਂਟੋਲੋਜੀ ਵਿਭਾਗ, ਲਿੰਕੋਪਿੰਗ, ਸਵੀਡਨ ਵਿੱਚ ਓਰਲ ਰੀਹੈਬਲੀਟੇਸ਼ਨ ਸੈਂਟਰ, ਅਤੇ ਉਮਰ ਦੇ ਇੱਕ ਸਮੂਹ ਅਤੇ ਲਿੰਗ-ਮੇਲ ਵਾਲੇ ਪੀਰੀਅਡੋਨਟਲੀ ਤੰਦਰੁਸਤ ਨਿਯੰਤਰਣਾਂ ਵਿੱਚ ਗੰਭੀਰ, ਇਲਾਜ ਨਾ ਕੀਤੇ ਗਏ ਪੀਰੀਅਡੋਨਟਾਈਟਸ ਦੇ ਨਾਲ (n = 30).

ਨਮੂਨੇ ਹਰੇਕ ਚਤੁਰਭੁਜ ਵਿੱਚ ਸਭ ਤੋਂ ਡੂੰਘੀ ਪੀਰੀਅਡੋਂਟਲ ਜੇਬ ਤੋਂ ਜਾਂ ਡੂੰਘੀਆਂ ਜੇਬਾਂ ਦੇ ਬਿਨਾਂ ਨਿਯੰਤਰਣ ਵਿਸ਼ਿਆਂ ਵਿੱਚ ਸਾਰੇ ਪਹਿਲੇ ਪ੍ਰੀਮੋਲਰਸ ਦੀ ਮੇਸੀਅਲ ਸਾਈਟ ਤੋਂ ਪ੍ਰਾਪਤ ਕੀਤੇ ਗਏ ਸਨ। ਸੁਪ੍ਰਾਗਿੰਗੀਵਲ ਪਲੇਕ ਨੂੰ ਲਾਰ ਦੇ ਗੰਦਗੀ ਤੋਂ ਬਿਨਾਂ ਹਟਾ ਦਿੱਤਾ ਗਿਆ ਸੀ, ਅਤੇ ਦੰਦ ਨੂੰ ਹਵਾ ਵਿਚ ਸੁੱਕਣ ਦੀ ਇਜਾਜ਼ਤ ਦਿੱਤੀ ਗਈ ਸੀ। GCF ਨੂੰ ਇਕੱਠਾ ਕਰਨ ਲਈ ਪੇਰੀਓਪੇਪਰ ਸਟ੍ਰਿਪਾਂ ਨੂੰ ਲਗਭਗ 1-2 ਮਿਲੀਮੀਟਰ ਦੀ ਡੂੰਘਾਈ ਤੱਕ ਪਾ ਦਿੱਤਾ ਗਿਆ ਸੀ, ਅਤੇ ਪੱਟੀਆਂ ਦੁਆਰਾ ਲੀਨ ਕੀਤੇ GCF ਦੀ ਮਾਤਰਾ ਪੇਰੀਓਟ੍ਰੋਨ 8000 (ਓਰਾਫਲੋ ਇੰਕ, NY) ਦੀ ਵਰਤੋਂ ਕਰਕੇ ਨਿਰਧਾਰਤ ਕੀਤੀ ਗਈ ਸੀ, ਜੋ ਕਿ ਪਹਿਲਾਂ ਦੱਸੇ ਅਨੁਸਾਰ ਕੈਲੀਬਰੇਟ ਕੀਤੀ ਗਈ ਸੀ (ਚੈਪਲ ਐਟ ਅਲ., 1999) ਪ੍ਰਤੀ ਮਰੀਜ਼ ਚਾਰ ਪੇਰੀਓਪੇਪਰ ਸਟ੍ਰਿਪਸ ਤੋਂ GCF ਨੂੰ ਪਤਲੇ ਬਫਰ (ਕਵਾਂਟਾਇਨ ਹਿਊਮਨ ਐਚਜੀਐਫ ਇਮਯੂਨੋਸੇ, ਆਰ ਐਂਡ ਡੀ ਸਿਸਟਮ, ਮਿਨੀਆਪੋਲਿਸ, ਐਮਐਨ) ਵਿੱਚ ਪੂਲ ਕੀਤਾ ਗਿਆ ਸੀ ਅਤੇ ਵਰਤਿਆ ਜਾਣ ਤੱਕ −20 ° C 'ਤੇ ਫ੍ਰੀਜ਼ ਕੀਤਾ ਗਿਆ ਸੀ।

ਨਮੂਨਿਆਂ ਨੂੰ ਵਰਤੋਂ ਤੋਂ ਪਹਿਲਾਂ ਪਿਘਲਾ ਦਿੱਤਾ ਗਿਆ ਸੀ ਅਤੇ ਨਿਰਜੀਵ ਪੀਬੀਐਸ (ਸਿਗਮਾ-ਐਲਡਰਿਕ, ਸਟਾਕਹੋਮ, ਸਵੀਡਨ) ਦੇ ਨਾਲ 1:20 ਅਨੁਪਾਤ ਵਿੱਚ ਪੇਤਲੀ ਪੈ ਗਿਆ ਸੀ। ਨਮੂਨੇ ਐਂਟੀ ਨਾਲ ਸਥਿਰ ਚਿਪ 'ਤੇ ਚਲਾਏ ਗਏ ਸਨ।ਪੀ. gingivalis ਐਂਟੀਬਾਡੀਜ਼ 5 μL/ਮਿੰਟ ਦੀ ਪ੍ਰਵਾਹ ਦਰ 'ਤੇ।

DNA-DNA ਚੈਕਰਬੋਰਡ ਹਾਈਬ੍ਰਿਡਾਈਜ਼ੇਸ਼ਨ ਵਿਸ਼ਲੇਸ਼ਣ

ਸਬਗਿੰਗੀਵਲ ਮਾਈਕਰੋਬਾਇਲ ਨਮੂਨੇ ਉਸੇ ਚਾਰ ਸਾਈਟਾਂ ਤੋਂ ਇਕੱਠੇ ਕੀਤੇ ਗਏ ਸਨ ਜਿਵੇਂ ਕਿ GCF ਨਮੂਨਾ. ਸੁਪਰੈਗਿੰਗੀਵਲ ਪਲੇਕ ਨੂੰ ਹਟਾ ਦਿੱਤਾ ਗਿਆ ਸੀ, ਅਤੇ ਜੜ੍ਹ ਦੀ ਸਤਹ ਨੂੰ ਸੁੱਕਣ ਦੀ ਇਜਾਜ਼ਤ ਦਿੱਤੀ ਗਈ ਸੀ। ਬੈਕਟੀਰੀਆ ਦੇ ਨਮੂਨੇ ਨੂੰ ਪੀਰੀਅਡੋਂਟਲ ਜੇਬ ਵਿੱਚ ਪਾਈ ਇੱਕ ਸਟੀਰਾਈਲ-ਐਂਡੋਡੌਨਟਿਕ ਪੇਪਰ ਪੁਆਇੰਟ ਪਾ ਕੇ ਇਕੱਠਾ ਕੀਤਾ ਗਿਆ ਸੀ ਜਿਸਦੀ ਵਰਤੋਂ ਉਸੇ ਚਾਰ ਸਾਈਟਾਂ ਤੋਂ ਸਬਗਿੰਗੀਵਲ ਬੈਕਟੀਰੀਆ ਦੇ ਨਮੂਨੇ ਇਕੱਠੇ ਕਰਨ ਲਈ ਕੀਤੀ ਗਈ ਸੀ ਜਿੱਥੇ GCF 20 ਸਕਿੰਟ ਲਈ ਇਕੱਠਾ ਕੀਤਾ ਗਿਆ ਸੀ, ਜਿਸਨੂੰ ਫਿਰ ਇੱਕ ਨਿਰਜੀਵ ਟੈਸਟ ਟਿਊਬ ਵਿੱਚ ਤਬਦੀਲ ਕੀਤਾ ਗਿਆ ਸੀ। ਨਮੂਨਿਆਂ ਦੀ ਓਰਲ ਮਾਈਕਰੋਬਾਇਓਲੋਜੀ ਅਤੇ ਇਮਯੂਨੋਲੋਜੀ ਵਿਭਾਗ, ਗੋਟੇਨਬਰਗ ਯੂਨੀਵਰਸਿਟੀ, ਸਵੀਡਨ ਵਿਖੇ ਕਾਰਵਾਈ ਕੀਤੀ ਗਈ ਸੀ, ਅਤੇ ਮੌਜੂਦਗੀ ਲਈ ਵਿਸ਼ਲੇਸ਼ਣ ਕੀਤਾ ਗਿਆ ਸੀ। ਪੀ. gingivalis, ਘੱਟੋ-ਘੱਟ 10,000 ਸੈੱਲਾਂ ਦੀ ਖੋਜ ਸੀਮਾ ਦੇ ਨਾਲ DNA-DNA ਚੈਕਰਬੋਰਡ ਹਾਈਬ੍ਰਿਡਾਈਜ਼ੇਸ਼ਨ ਤਕਨੀਕ ਦੀ ਵਰਤੋਂ ਕਰਦੇ ਹੋਏ (ਸੋਕ੍ਰਾਂਸਕੀ ਐਟ ਅਲ., 1994)। ਨਮੂਨੇ ਸਾਡੇ ਪਿਛਲੇ ਅਧਿਐਨਾਂ ਵਿੱਚ ਵੀ ਸ਼ਾਮਲ ਕੀਤੇ ਗਏ ਸਨ (ਲੋਨ ਐਟ ਅਲ., 2014 ).

ਰੀਅਲ-ਟਾਈਮ ਪੌਲੀਮੇਰੇਜ਼ ਚੇਨ ਪ੍ਰਤੀਕ੍ਰਿਆ

ਦਾ ਪਤਾ ਲਗਾਉਣ ਦੀ SPR ਵਿਸ਼ਲੇਸ਼ਣ ਵਿਧੀ ਨੂੰ ਪ੍ਰਮਾਣਿਤ ਕਰਨ ਲਈ ਰੀਅਲ-ਟਾਈਮ ਪੀਸੀਆਰ ਵਿਸ਼ਲੇਸ਼ਣ ਕੀਤਾ ਗਿਆ ਸੀ ਪੀ. gingivalis GCF ਨਮੂਨਿਆਂ ਵਿੱਚ. ਨਮੂਨੇ ਜਿਨ੍ਹਾਂ ਨੇ ਡੀਐਨਏ-ਡੀਐਨਏ ਚੈਕਰਬੋਰਡ ਵਿਸ਼ਲੇਸ਼ਣ ਅਤੇ ਐਸਪੀਆਰ ਤਰੀਕਿਆਂ ਵਿੱਚ ਵੱਖੋ-ਵੱਖਰੇ ਜਵਾਬ ਦਿਖਾਏ ਸਨ ਚੁਣੇ ਗਏ ਸਨ ਅਤੇ ਸਿਹਤਮੰਦ ਨਿਯੰਤਰਣਾਂ ਨਾਲ ਤੁਲਨਾ ਕੀਤੀ ਗਈ ਸੀ। ਪੀ. gingivalis TGTAGATGACTGATGTGTAAAACC ਦਾ 16S rRNA ਫਾਰਵਰਡ ਪ੍ਰਾਈਮਰ ਕ੍ਰਮ ਅਤੇ ACGTCATCCCCCCTCTCTCTC ਦਾ ਰਿਵਰਸ ਪ੍ਰਾਈਮਰ ਕ੍ਰਮ ਵਰਤਿਆ ਗਿਆ ਸੀ। SYBR ਗ੍ਰੀਨ (Maxima® SYBR ਗ੍ਰੀਨ/ROX qPCR ਮਾਸਟਰ ਮਿਕਸ, ਫਰਮੈਂਟਾਸ, ਸਵੀਡਨ) ਦੀ ਵਰਤੋਂ ਕੀਤੀ ਗਈ ਸੀ, ਅਤੇ ਪੀਸੀਆਰ ਸ਼ਰਤਾਂ ਨੂੰ 10 ਮਿੰਟ ਲਈ 95 °C 'ਤੇ ਸ਼ੁਰੂਆਤੀ ਵਿਨਾਸ਼ਕਾਰੀ ਲਈ ਸੈੱਟ ਕੀਤਾ ਗਿਆ ਸੀ, ਜਿਸ ਤੋਂ ਬਾਅਦ 95 °C, 40 ਚੱਕਰਾਂ ਲਈ 15 ਸਕਿੰਟ, ਅਤੇ ਫਿਰ 60 °C, 7900 HT ਰੀਅਲ-ਟਾਈਮ ਪੀਸੀਆਰ ਯੰਤਰ (ਅਪਲਾਈਡ ਬਾਇਓਸਿਸਟਮ) ਵਿੱਚ 60 ਸਕਿੰਟ।

ਟ੍ਰਾਂਸਮਿਸ਼ਨ ਇਲੈਕਟ੍ਰੋਨ ਮਾਈਕ੍ਰੋਸਕੋਪੀ

ਟਰਾਂਸਮਿਸ਼ਨ ਇਲੈਕਟ੍ਰੋਨ ਮਾਈਕ੍ਰੋਸਕੋਪੀ ਐਂਟੀ- ਦੀ ਬਾਈਡਿੰਗ ਸਾਂਝ ਦਾ ਅਧਿਐਨ ਕਰਨ ਲਈ ਕੀਤੀ ਗਈ ਸੀ।ਪੀ. gingivalis ਨੂੰ ਪੀ. gingivalis. ਪੀ. gingivalis ਪੀ.ਬੀ.ਐਸ. ਵਿੱਚ ਪਤਲਾ 1:20 ਐਂਟੀ- ਨਾਲ ਪ੍ਰਫੁੱਲਤ ਕੀਤਾ ਗਿਆ ਸੀਪੀ. gingivalis ਪੀਬੀਐਸ ਵਿੱਚ ਐਂਟੀਬਾਡੀਜ਼ 1:100 ਪਤਲੇ ਹੋਏ। ਵਾਧੂ ਐਂਟੀਬਾਡੀਜ਼ ਪੀਬੀਐਸ ਨਾਲ ਧੋਤੇ ਗਏ ਸਨ, ਅਤੇ ਸੋਨੇ ਦੇ ਲੇਬਲ ਵਾਲੇ ਐਂਟੀ-ਹਿਊਮਨ ਆਈਜੀਜੀ ਨੂੰ ਅਨੁਪਾਤ 1:1000 (ਨੈਨੋ ਗੋਲਡ ਪ੍ਰੋਬਜ਼, NY) ਵਿੱਚ ਜੋੜਿਆ ਗਿਆ ਸੀ। ਮਿਸ਼ਰਣ ਨੂੰ 1 ਘੰਟੇ ਲਈ 37 ਡਿਗਰੀ ਸੈਲਸੀਅਸ 'ਤੇ ਪ੍ਰਫੁੱਲਤ ਕੀਤਾ ਗਿਆ ਸੀ। ਵਾਧੂ ਐਂਟੀਬਾਡੀਜ਼ PBS ਨਾਲ ਧੋਤੇ ਗਏ ਸਨ ਅਤੇ 1% ਓਸਮੀਅਮ ਟੈਟਰੋਆਕਸਾਈਡ (ਸਿਗਮਾ-ਐਲਡਰਿਕ, ਸਟਾਕਹੋਮ, ਸਵੀਡਨ) ਨਾਲ 200 µm ਜਾਲ ਫਾਰਮਵਰ-ਕੋਟੇਡ ਕਾਪਰ ਗਰਿੱਡ (ਅਗਰ ਸਾਇੰਟਿਫਿਕ, ਸਟੈਨਸਟੇਡ, ਯੂਕੇ) 'ਤੇ ਮਾਊਂਟ ਹੋਣ ਤੱਕ ਫਿਕਸ ਕੀਤੇ ਗਏ ਸਨ। Uranyl ਐਸੀਟੇਟ (2%, Sigma-Aldrich, Stockholm, Sweden) JEOL 1230 ਟਰਾਂਸਮਿਸ਼ਨ ਇਲੈਕਟ੍ਰੋਨ ਮਾਈਕ੍ਰੋਸਕੋਪ (ਡਿਪਾਰਟਮੈਂਟ ਆਫ਼ ਪੈਥੋਲੋਜੀ, ਲਿੰਕੋਪਿੰਗ ਯੂਨੀਵਰਸਿਟੀ, ਸਵੀਡਨ) ਵਿੱਚ ਜਾਂਚ ਕਰਨ ਤੋਂ ਪਹਿਲਾਂ ਸਟੈਨਿੰਗ ਲਈ ਵਰਤਿਆ ਗਿਆ ਸੀ।

ਅੰਕੜਾ ਵਿਸ਼ਲੇਸ਼ਣ

ਗ੍ਰਾਫ ਪੈਡ ਪ੍ਰਿਜ਼ਮ, ਸੰਸਕਰਣ 5.0 (ਗ੍ਰਾਫਪੈਡ ਸੌਫਟਵੇਅਰ, ਇੰਕ.) ਦੀ ਵਰਤੋਂ ਕਰਕੇ ਐਸਪੀਆਰ ਵਿਸ਼ਲੇਸ਼ਣ ਅਤੇ ਡੀਐਨਏ-ਡੀਐਨਏ ਚੈਕਰਬੋਰਡ ਵਿਸ਼ਲੇਸ਼ਣ, ਐਸਪੀਆਰ ਵਿਸ਼ਲੇਸ਼ਣ ਅਤੇ ਰਿਵਰਸ ਟ੍ਰਾਂਸਕ੍ਰਿਪਸ਼ਨ-ਪੀਸੀਆਰ (ਆਰਟੀ-ਪੀਸੀਆਰ) ਦੇ ਦੋ ਤਰੀਕਿਆਂ ਤੋਂ ਪ੍ਰਾਪਤ ਨਤੀਜਿਆਂ ਦੀ ਤੁਲਨਾ ਕਰਨ ਲਈ ਚੀ ਵਰਗ ਵਿਸ਼ਲੇਸ਼ਣ ਕੀਤਾ ਗਿਆ ਸੀ। , ਕੈਲੀਫੋਰਨੀਆ, ਅਮਰੀਕਾ)। ਆਜ਼ਾਦੀ ਦੀ ਡਿਗਰੀ ਲਈ ਚੀ ਵਰਗ ਵੰਡ ਸਾਰਣੀ ਤੋਂ 1 ਅਤੇ ਪੀ > 0.05 ਨੂੰ ਨਲ ਪਰਿਕਲਪਨਾ (Fisher RAaY, 1963) ਨੂੰ ਅਸਵੀਕਾਰ ਕਰਨ ਵਜੋਂ ਮੰਨਿਆ ਗਿਆ ਸੀ ਜਿਸ ਵਿੱਚ ਦੋ ਤਰੀਕਿਆਂ ਦਾ ਵਿਸ਼ਲੇਸ਼ਣ ਕੀਤਾ ਜਾ ਰਿਹਾ ਹੈ।


ਸਰਫੇਸ ਪਲਾਜ਼ਮੋਨ ਰੈਜ਼ੋਨੈਂਸ (SPR) ਅਣੂ ਭਾਰ ਸੀਮਾ ਦਾ ਅਨੁਮਾਨ? - ਜੀਵ ਵਿਗਿਆਨ

ਸਰਫੇਸ ਪਲਾਜ਼ਮੋਨ ਰੈਜ਼ੋਨੈਂਸ (SPR) ਇੱਕ ਅਜਿਹਾ ਵਰਤਾਰਾ ਹੈ ਜਿਸ ਵਿੱਚ ਫੋਟੌਨ ਇੱਕ ਧਾਤੂ-ਡਾਇਲੇਕਟ੍ਰਿਕ ਇੰਟਰਫੇਸ 'ਤੇ ਯਾਤਰਾ ਕਰਨ ਵਾਲੀ ਸਤਹ ਇਲੈਕਟ੍ਰੋਨ ਘਣਤਾ ਤਰੰਗ ਨਾਲ ਊਰਜਾ ਨੂੰ ਜੋੜਨ ਲਈ ਬਣਾਏ ਜਾਂਦੇ ਹਨ। ਜੋੜ ਇੱਕ ਖਾਸ ਊਰਜਾ ਅਤੇ ਗਤੀ 'ਤੇ ਵਾਪਰਦਾ ਹੈ, ਜਿਸ ਨੂੰ ਸਮੂਹਿਕ ਤੌਰ 'ਤੇ ਗੂੰਜਣ ਦੀ ਸਥਿਤੀ ਕਿਹਾ ਜਾਂਦਾ ਹੈ, ਜਿਸ ਨਾਲ ਪ੍ਰਤੀਬਿੰਬਿਤ ਰੋਸ਼ਨੀ ਵਿੱਚ ਕਮੀ ਆਉਂਦੀ ਹੈ। ਡਿੱਪ ਦੀਆਂ ਵਿਸ਼ੇਸ਼ਤਾਵਾਂ ਇੰਟਰਫੇਸ 'ਤੇ ਸਮੱਗਰੀ ਦੀਆਂ ਵਿਸ਼ੇਸ਼ਤਾਵਾਂ ਦਾ ਇੱਕ ਕਾਰਜ ਹਨ ਇਸਲਈ ਡਿੱਪ ਦੀ ਨਿਗਰਾਨੀ ਕਰਨਾ ਸਥਾਨਕ ਸਤਹ ਦੇ ਵਾਤਾਵਰਣ ਬਾਰੇ ਜਾਣਕਾਰੀ ਪ੍ਰਦਾਨ ਕਰਦਾ ਹੈ। ਹਾਲ ਹੀ ਦੇ ਸਾਲਾਂ ਵਿੱਚ ਐਸਪੀਆਰ ਟੈਕਨੋਲੋਜੀ ਵਿੱਚ ਮਾਈਨਿਏਚੁਰਾਈਜ਼ੇਸ਼ਨ, ਵਧੀ ਹੋਈ ਸੰਵੇਦਨਸ਼ੀਲਤਾ, ਉੱਚ ਥ੍ਰਰੂਪੁਟ ਅਤੇ ਮਲਟੀਮੋਡਲ ਪਹੁੰਚ ਵੱਲ ਇੱਕ ਧੱਕਾ ਦੇਖਿਆ ਗਿਆ ਹੈ। ਇਹ ਥੀਸਿਸ ਐਸਪੀਆਰ ਬਾਇਓਸੈਂਸਰਾਂ ਦੀ ਕਾਰਗੁਜ਼ਾਰੀ ਨੂੰ ਬਿਹਤਰ ਬਣਾਉਣ ਲਈ ਦੋ ਤਰੀਕਿਆਂ 'ਤੇ ਕੇਂਦ੍ਰਤ ਕਰਦਾ ਹੈ। ਪਹਿਲਾਂ, ਇੱਕ ਸਤਹ ਪਲਾਜ਼ਮੋਨ ਬੈਂਡਗੈਪ ਢਾਂਚੇ ਦੀ ਵਰਤੋਂ ਦੁਆਰਾ SPR ਸੰਵੇਦਨਸ਼ੀਲਤਾ ਵਿੱਚ ਸੁਧਾਰ ਕੀਤਾ ਗਿਆ ਹੈ। ਇੱਥੇ ਇਹ ਦਿਖਾਇਆ ਗਿਆ ਹੈ ਕਿ ਅਜਿਹੇ ਬੈਂਡਗੈਪ ਦੇ ਕਿਨਾਰੇ ਦੇ ਨੇੜੇ ਕੋਣੀ ਪੁੱਛਗਿੱਛ ਮੋਡ ਵਿੱਚ ਇੱਕ ਐਸਪੀਆਰ ਬਾਇਓਸੈਂਸਰ ਨੂੰ ਚਲਾਉਣ ਦੇ ਨਤੀਜੇ ਵਜੋਂ ਸਮਾਨ ਸਥਿਤੀਆਂ ਵਿੱਚ ਇੱਕ ਸਮਤਲ ਧਾਤੂ ਸਤਹ ਉੱਤੇ ਐਸਪੀਆਰ ਦੀ ਤੁਲਨਾ ਵਿੱਚ ਸੰਵੇਦਨਸ਼ੀਲਤਾ ਵਿੱਚ ਛੇ ਗੁਣਾ ਵਾਧਾ ਹੋਵੇਗਾ। ਦੂਜਾ, ਚਿੱਤਰ ਪ੍ਰੋਸੈਸਿੰਗ 'ਤੇ ਅਧਾਰਤ ਇੱਕ ਨਵੀਂ ਡਾਟਾ ਵਿਸ਼ਲੇਸ਼ਣ ਤਕਨੀਕ ਦੀ ਵਰਤੋਂ ਕਰਕੇ ਖੋਜ ਦੀ ਸੀਮਾ ਨੂੰ ਸੁਧਾਰਨ ਲਈ ਇੱਕ ਢੰਗ ਦਿਖਾਇਆ ਗਿਆ ਹੈ। ਇੱਕ ਮਲਟੀਮੋਡਲ ਸਤਹ ਪਲਾਜ਼ਮੋਨ ਪੁੱਛਗਿੱਛ ਤਕਨੀਕ ਦੀ ਵਰਤੋਂ ਇੱਕ ਸਤਹ ਤੋਂ ਸਪੈਕਟਰੋ-ਐਂਗੁਲਰ ਡਿਸਪਰਸ਼ਨ ਦੀ ਇੱਕ 2-ਡੀ ਪ੍ਰਤੀਬਿੰਬ ਬਣਾਉਣ ਲਈ ਕੀਤੀ ਜਾਂਦੀ ਹੈ ਜੋ ਫਿਰ ਸਪੈਕਟਰੋ-ਐਂਗੁਲਰ ਜਾਣਕਾਰੀ ਦਾ ਸ਼ੋਸ਼ਣ ਕਰਨ ਲਈ ਵਿਕਸਤ ਇੱਕ ਆਈਗਨਵੈਕਟਰ ਵਿਸ਼ਲੇਸ਼ਣ ਤਕਨੀਕ ਦੀ ਵਰਤੋਂ ਕਰਕੇ ਸਤਹ ਦੇ ਵਾਤਾਵਰਣ ਬਾਰੇ ਜਾਣਕਾਰੀ ਕੱਢਣ ਲਈ ਵਰਤੀ ਜਾਂਦੀ ਹੈ। ਸਪੈਕਟਰੋ-ਐਂਗੁਲਰ ਡੇਟਾ 'ਤੇ, ਡਬਲ ਪ੍ਰੋਜੇਕਸ਼ਨ ਵਿਧੀ (DPM) ਦੇ ਤੌਰ 'ਤੇ ਮਨੋਨੀਤ ਨਾਵਲ ਆਈਗਨਵੈਕਟਰ ਤਕਨੀਕ ਦੀ ਵਰਤੋਂ ਕਰਦੇ ਹੋਏ, 5x10-9 ਰਿਫ੍ਰੈਕਟਿਵ ਇੰਡੈਕਸ ਯੂਨਿਟਾਂ (RIU) ਦੀ ਸਿਧਾਂਤਕ ਖੋਜ ਸੀਮਾ ਦੇ ਨਾਲ ਇੱਕ ਵਿਆਪਕ ਗਤੀਸ਼ੀਲ ਰੇਂਜ ਵਿੱਚ ਰਿਫ੍ਰੈਕਟਿਵ ਸੂਚਕਾਂਕ ਅਨੁਮਾਨਾਂ ਦੇ ਨਤੀਜੇ ਹੁੰਦੇ ਹਨ। ਮੌਜੂਦਾ ਸਭ ਤੋਂ ਵੱਧ ਸੰਵੇਦਨਸ਼ੀਲਤਾ ਪੜਾਅ-ਅਧਾਰਿਤ ਤਰੀਕਿਆਂ ਲਈ। ਪ੍ਰਯੋਗਾਤਮਕ ਕੰਮ 2x10-6 RIU ਦੇ ਇੱਕ ਪ੍ਰਾਪਤ ਰੈਜ਼ੋਲਿਊਸ਼ਨ ਦੇ ਨਾਲ ਰੀਅਲ-ਟਾਈਮ ਵਿੱਚ ਛੋਟੇ ਅਣੂ ਵੇਟ ਰੀਐਕਟੈਂਟਸ (∼400 ਡਾਲਟਨ) ਦੇ ਨਾਲ ਬਾਇਓਮੋਲੀਕਿਊਲਰ ਪਰਸਪਰ ਕ੍ਰਿਆਵਾਂ ਦੀ ਨਿਗਰਾਨੀ ਕਰਨ ਦੇ ਸਮਰੱਥ DPM ਵਿਧੀ ਨੂੰ ਦਰਸਾਉਂਦਾ ਹੈ।


ਸਰਫੇਸ ਪਲਾਜ਼ਮੋਨ ਰੈਜ਼ੋਨੈਂਸ ਸੈਂਸਿੰਗ: ਸ਼ੁੱਧ ਬਾਇਓਮੋਲੀਕਿਊਲਸ ਤੋਂ ਬਰਕਰਾਰ ਸੈੱਲਾਂ ਤੱਕ

ਸਰਫੇਸ ਪਲਾਜ਼ਮੋਨ ਰੈਜ਼ੋਨੈਂਸ (SPR) 1980 ਦੇ ਦਹਾਕੇ ਵਿੱਚ ਪਹਿਲੇ ਐਸਪੀਆਰ-ਅਧਾਰਿਤ ਇਮਯੂਨੋਸੈਂਸਰ ਦੀ ਖੋਜ ਤੋਂ ਬਾਅਦ ਬਾਇਓਮੋਲੀਕਿਊਲਸ ਦੇ ਵਿਚਕਾਰ ਬਾਈਡਿੰਗ ਗਤੀ ਵਿਗਿਆਨ ਨੂੰ ਮਾਪਣ ਲਈ ਇੱਕ ਚੰਗੀ ਤਰ੍ਹਾਂ ਮਾਨਤਾ ਪ੍ਰਾਪਤ ਲੇਬਲ-ਮੁਕਤ ਤਕਨੀਕ ਬਣ ਗਈ ਹੈ। ਐਸਪੀਆਰ ਵਿਸ਼ਲੇਸ਼ਣ ਲਈ ਸਭ ਤੋਂ ਪ੍ਰਸਿੱਧ ਅਤੇ ਪਰੰਪਰਾਗਤ ਫਾਰਮੈਟ ਅਸਲ-ਸਮੇਂ ਦੇ ਆਪਟੀਕਲ ਸਿਗਨਲਾਂ ਦੀ ਨਿਗਰਾਨੀ ਕਰਨਾ ਹੈ ਜਦੋਂ ਲਿਗੈਂਡ ਅਣੂਆਂ ਵਾਲਾ ਘੋਲ ਸ਼ੁੱਧ ਰੀਸੈਪਟਰ ਅਣੂਆਂ ਨਾਲ ਕਾਰਜਸ਼ੀਲ ਇੱਕ ਸੈਂਸਰ ਸਬਸਟਰੇਟ ਉੱਤੇ ਵਹਿ ਰਿਹਾ ਹੈ। ਹਾਲ ਹੀ ਦੇ ਸਾਲਾਂ ਵਿੱਚ, SPR ਇਮੇਜਿੰਗ ਤਕਨੀਕਾਂ ਦੀਆਂ ਕਈ ਕਿਸਮਾਂ ਦੇ ਤੇਜ਼ੀ ਨਾਲ ਵਿਕਾਸ ਨੇ ਉੱਚ ਸਥਾਨਿਕ ਅਤੇ ਅਸਥਾਈ ਸੰਕਲਪਾਂ ਅਤੇ ਭਰੋਸੇਯੋਗ ਸੰਵੇਦਨਸ਼ੀਲਤਾ ਦੇ ਨਾਲ ਸਿੰਗਲ ਜੀਵਤ ਸੈੱਲਾਂ ਦੇ ਅੰਦਰ ਸਥਾਨਕ ਪੁੰਜ ਘਣਤਾ ਦੀ ਗਤੀਸ਼ੀਲ ਵੰਡ ਨੂੰ ਮੈਪ ਕਰਨ ਦੀ ਇਜਾਜ਼ਤ ਦਿੱਤੀ ਹੈ। ਅਜਿਹੀ ਸਮਰੱਥਾ ਨੇ ਤੁਰੰਤ ਇੱਕ ਲੇਬਲ-ਮੁਕਤ, ਮਾਤਰਾਤਮਕ, ਅਤੇ ਸਿੰਗਲ ਸੈੱਲ ਤਰੀਕੇ ਨਾਲ ਮਹੱਤਵਪੂਰਨ ਬਾਇਓਮੋਲੀਕਿਊਲਸ ਅਤੇ ਬਰਕਰਾਰ ਸੈੱਲਾਂ ਵਿਚਕਾਰ ਆਪਸੀ ਤਾਲਮੇਲ ਦੀ ਜਾਂਚ ਕਰਨ ਦੇ ਯੋਗ ਬਣਾਇਆ, ਜਿਸ ਨਾਲ ਸੈੱਲ-ਅਧਾਰਤ ਐਸਪੀਆਰ ਬਾਇਓ ਵਿਸ਼ਲੇਸ਼ਣ ਦੇ ਇੱਕ ਦਿਲਚਸਪ ਨਵੇਂ ਰੁਝਾਨ ਵੱਲ ਅਗਵਾਈ ਕੀਤੀ ਗਈ। ਇਸ ਰੁਝਾਨ ਲੇਖ ਵਿੱਚ, ਅਸੀਂ ਪਹਿਲਾਂ ਕ੍ਰਮਵਾਰ ਪ੍ਰਿਜ਼ਮ ਅਤੇ ਉਦੇਸ਼ 'ਤੇ ਅਧਾਰਤ ਦੋ ਕਿਸਮਾਂ ਦੀਆਂ SPR ਇਮੇਜਿੰਗ ਤਕਨੀਕਾਂ ਦੇ ਸਿਧਾਂਤ ਅਤੇ ਤਕਨੀਕੀ ਵਿਸ਼ੇਸ਼ਤਾਵਾਂ ਦਾ ਵਰਣਨ ਕਰਦੇ ਹਾਂ। ਫਿਰ ਅਸੀਂ ਬੁਨਿਆਦੀ ਸੈੱਲ ਜੀਵ ਵਿਗਿਆਨ ਅਤੇ ਨਸ਼ੀਲੇ ਪਦਾਰਥਾਂ ਦੀ ਖੋਜ ਦੋਵਾਂ ਵਿੱਚ ਬਰਕਰਾਰ ਸੈੱਲ-ਅਧਾਰਿਤ ਐਪਲੀਕੇਸ਼ਨਾਂ ਦਾ ਸਰਵੇਖਣ ਕਰਦੇ ਹਾਂ। ਅਸੀਂ ਲੇਖ ਨੂੰ ਭਵਿੱਖ ਦੇ ਵਿਕਾਸ 'ਤੇ ਟਿੱਪਣੀਆਂ ਅਤੇ ਦ੍ਰਿਸ਼ਟੀਕੋਣਾਂ ਨਾਲ ਸਮਾਪਤ ਕਰਦੇ ਹਾਂ।

ਸਰਫੇਸ ਪਲਾਜ਼ਮੋਨ ਰੈਜ਼ੋਨੈਂਸ (SPR) ਇਮੇਜਿੰਗ ਤਕਨੀਕਾਂ ਵਿੱਚ ਹਾਲੀਆ ਵਿਕਾਸ ਸਿੰਗਲ ਜੀਵਿਤ ਸੈੱਲਾਂ ਦੇ ਅੰਦਰ ਪੁੰਜ-ਵੰਡ ਨੂੰ ਲੇਬਲ-ਮੁਕਤ ਮੈਪਿੰਗ ਕਰਨ ਦੀ ਇਜਾਜ਼ਤ ਦਿੰਦਾ ਹੈ, ਜਿਸ ਨਾਲ ਸ਼ੁੱਧ ਬਾਇਓਮੋਲੀਕਿਊਲਜ਼ ਨਾਲ ਕੰਮ ਕਰਨ ਵਾਲੇ ਸਮਰੂਪ ਸਬਸਟਰੇਟਾਂ ਤੋਂ ਲੈ ਕੇ ਵਿਅਕਤੀਗਤ ਜੀਵਿਤ ਸੈੱਲਾਂ ਵਾਲੇ ਵਿਭਿੰਨ ਸਬਸਟਰੇਟਾਂ ਤੱਕ ਬਾਇਓਮੋਲੀਕਿਊਲਰ ਪਰਸਪਰ ਕਿਰਿਆਵਾਂ ਦੇ ਅਧਿਐਨ ਵਿੱਚ ਬਹੁਤ ਜ਼ਿਆਦਾ ਵਿਸਥਾਰ ਹੁੰਦਾ ਹੈ।


ਇਮੋਬਿਲਾਈਜ਼ਡ ਪਪੈਨ 'ਤੇ ਆਧਾਰਿਤ ਸਿਸਟੈਟੀਨ ਨਿਰਧਾਰਨ ਲਈ ਸਰਫੇਸ ਪਲਾਜ਼ਮੋਨ ਰੈਜ਼ੋਨੈਂਸ ਇਮੇਜਿੰਗ (ਐਸਪੀਆਰਆਈ) ਸੈਂਸਰ

ਇੱਕ ਸਰਫੇਸ ਪਲਾਜ਼ਮੋਨ ਰੈਜ਼ੋਨੈਂਸ ਇਮੇਜਿੰਗ (SPRI) ਸੈਂਸਰ cystatin ਦੇ ਖਾਸ ਨਿਰਧਾਰਨ ਲਈ ਵਿਕਸਤ ਕੀਤਾ ਗਿਆ ਹੈ। ਸੰਵੇਦਕ ਵਿੱਚ ਸਥਿਰ ਪੈਪੈਨ ਹੁੰਦਾ ਹੈ, ਜੋ ਕਿ ਘੋਲ ਤੋਂ ਸਿਸਟੈਟੀਨ ਨੂੰ ਜੋੜਦਾ ਹੈ। N- Hydroxysuccinimide (NHS) ਅਤੇ N-Ethyl-N- (3-dimethyl aminopropyl) carbodiimide (EDC) ਦੇ ਨਾਲ ਸਰਗਰਮ ਕੀਤੇ Papain ਨੂੰ ਇੱਕ ਅਮੀਨ-ਸੰਸ਼ੋਧਿਤ ਸੋਨੇ ਦੀ ਸਤਹ 'ਤੇ ਸਥਿਰ ਕੀਤਾ ਗਿਆ ਸੀ। ਸਿਸਟਾਮਾਈਨ ਦੀ ਵਰਤੋਂ ਸੋਨੇ ਦੀ ਸਤਹ ਨੂੰ ਸੋਧਣ ਲਈ ਕੀਤੀ ਜਾਂਦੀ ਸੀ। Papain ਗਾੜ੍ਹਾਪਣ ਅਤੇ ਪਰਸਪਰ ਪ੍ਰਭਾਵ ਦੇ pH ਨੂੰ ਅਨੁਕੂਲ ਬਣਾਇਆ ਗਿਆ ਸੀ. 1.5 μg mL-1 ਦੇ papain ਦੀ ਇਕਾਗਰਤਾ ਅਤੇ 6.5 ਦੀ pH ਨੂੰ ਅਨੁਕੂਲ ਚੁਣਿਆ ਗਿਆ ਸੀ। ਪਰਸਪਰ ਪ੍ਰਭਾਵ ਦੀ ਵਿਸ਼ੇਸ਼ਤਾ ਮਨੁੱਖੀ ਐਲਬਿਊਮਿਨ ਨਾਲ ਪਰਸਪਰ ਪ੍ਰਭਾਵ ਦੀ ਘਾਟ ਦੁਆਰਾ ਪ੍ਰਮਾਣਿਤ ਕੀਤੀ ਗਈ ਸੀ। ਸੈਂਸਰਾਂ ਦੀ ਗਤੀਸ਼ੀਲ ਪ੍ਰਤੀਕਿਰਿਆ ਸੀਮਾ 0 ਅਤੇ 0.6 μg mL-1 ਦੇ ਵਿਚਕਾਰ ਹੈ, ਅਤੇ ਖੋਜ ਦੀ ਸੀਮਾ 0.09 μg mL-1 ਹੈ। ਨਤੀਜਿਆਂ ਨੂੰ ਪੀਟੀਆਈਏ (ਪਾਰਟੀਕਲ ਇਨਹਾਂਸਡ ਇਮਯੂਨੋਟੁਰਬੀਡੀਮੀਟ੍ਰਿਕ ਅਸੇ) ਵਿਧੀ ਨਾਲ ਤੁਲਨਾ ਕਰਕੇ ਪ੍ਰਮਾਣਿਤ ਕੀਤਾ ਗਿਆ ਸੀ ਜੋ ਚੰਗਾ ਸਮਝੌਤਾ ਦਿਖਾ ਰਿਹਾ ਸੀ। ਚਿਕਨ ਅੰਡੇ ਦੇ ਸਫੇਦ cystatin ਜਾਂ Cystatin C ਦਾ ਇੱਕ ਕੈਲੀਬ੍ਰੇਸ਼ਨ ਕਰਵ ਵਰਤਿਆ ਗਿਆ ਸੀ। ਸੰਵੇਦਕ ਸੰਭਾਵੀ ਪ੍ਰਦਰਸ਼ਿਤ ਕਰਨ ਲਈ, ਸਿਸਟੈਟੀਨ ਸੀ ਖੂਨ ਦੇ ਪਲਾਜ਼ਮਾ, ਪਿਸ਼ਾਬ ਅਤੇ ਥੁੱਕ ਵਿੱਚ ਨਿਰਧਾਰਤ ਕੀਤਾ ਗਿਆ ਸੀ, ਸਾਹਿਤ ਵਿੱਚ ਰਿਪੋਰਟ ਕੀਤੇ ਗਏ ਡੇਟਾ ਨਾਲ ਚੰਗੀ ਸਹਿਮਤੀ ਦਿਖਾਉਂਦੇ ਹੋਏ। ਲਿਊਕੇਮੀਆ ਤੋਂ ਪੀੜਤ ਲੋਕਾਂ ਦੇ ਖੂਨ ਦੇ ਪਲਾਜ਼ਮਾ ਵਿੱਚ ਸਿਸਟੈਟੀਨ ਦੀ ਗਾੜ੍ਹਾਪਣ ਦੇ ਨਤੀਜੇ ਸਿਸਟੈਟੀਨ ਦੇ ਆਮ ਪੱਧਰ ਤੋਂ ਘੱਟ ਪਾਏ ਗਏ ਸਨ।

ਪ੍ਰੋਟੀਨ ਅਤੇ ਪੇਪਟਾਇਡ ਅੱਖਰ

ਸਿਰਲੇਖ: ਇਮੋਬਿਲਾਈਜ਼ਡ ਪਪੈਨ 'ਤੇ ਆਧਾਰਿਤ ਸਿਸਟੈਟੀਨ ਨਿਰਧਾਰਨ ਲਈ ਸਰਫੇਸ ਪਲਾਜ਼ਮੋਨ ਰੈਜ਼ੋਨੈਂਸ ਇਮੇਜਿੰਗ (ਐਸਪੀਆਰਆਈ) ਸੈਂਸਰ

ਵੌਲਯੂਮ: 18 ਮੁੱਦੇ: 1

ਲੇਖਕ:ਈ. ਗੋਰੋਡਕੀਵਿਚ ਅਤੇ ਜੇ. ਲੁਜ਼ਕਜ਼ੀਨ

ਮਾਨਤਾ:ਇਲੈਕਟ੍ਰੋਕੈਮਿਸਟਰੀ ਵਿਭਾਗ, ਇੰਸਟੀਚਿਊਟ ਆਫ਼ ਕੈਮਿਸਟਰੀ, ਯੂਨੀਵਰਸਿਟੀ ਆਫ਼ ਬਿਆਲਿਸਟੋਕ, ਅਲ.ਜੇ. ਪਿਲਸਡਸਕੀਗੋ11/4, 15-443 ਬਿਆਲਿਸਟੋਕ, ਪੋਲੈਂਡ।

ਸਾਰ: ਇੱਕ ਸਰਫੇਸ ਪਲਾਜ਼ਮੋਨ ਰੈਜ਼ੋਨੈਂਸ ਇਮੇਜਿੰਗ (SPRI) ਸੈਂਸਰ cystatin ਦੇ ਖਾਸ ਨਿਰਧਾਰਨ ਲਈ ਵਿਕਸਤ ਕੀਤਾ ਗਿਆ ਹੈ। ਸੰਵੇਦਕ ਵਿੱਚ ਸਥਿਰ ਪੈਪੈਨ ਹੁੰਦਾ ਹੈ, ਜੋ ਕਿ ਘੋਲ ਤੋਂ ਸਿਸਟੈਟੀਨ ਨੂੰ ਜੋੜਦਾ ਹੈ। N- Hydroxysuccinimide (NHS) ਅਤੇ N-Ethyl-N- (3-dimethyl aminopropyl) carbodiimide (EDC) ਦੇ ਨਾਲ ਸਰਗਰਮ ਕੀਤੇ Papain ਨੂੰ ਇੱਕ ਅਮੀਨ-ਸੰਸ਼ੋਧਿਤ ਸੋਨੇ ਦੀ ਸਤਹ 'ਤੇ ਸਥਿਰ ਕੀਤਾ ਗਿਆ ਸੀ। ਸਿਸਟਾਮਾਈਨ ਦੀ ਵਰਤੋਂ ਸੋਨੇ ਦੀ ਸਤਹ ਨੂੰ ਸੋਧਣ ਲਈ ਕੀਤੀ ਜਾਂਦੀ ਸੀ। Papain ਗਾੜ੍ਹਾਪਣ ਅਤੇ ਪਰਸਪਰ ਪ੍ਰਭਾਵ ਦੇ pH ਨੂੰ ਅਨੁਕੂਲ ਬਣਾਇਆ ਗਿਆ ਸੀ. 1.5 μg mL-1 ਦੇ papain ਦੀ ਇਕਾਗਰਤਾ ਅਤੇ 6.5 ਦੀ pH ਨੂੰ ਅਨੁਕੂਲ ਚੁਣਿਆ ਗਿਆ ਸੀ। ਪਰਸਪਰ ਪ੍ਰਭਾਵ ਦੀ ਵਿਸ਼ੇਸ਼ਤਾ ਮਨੁੱਖੀ ਐਲਬਿਊਮਿਨ ਨਾਲ ਪਰਸਪਰ ਪ੍ਰਭਾਵ ਦੀ ਘਾਟ ਦੁਆਰਾ ਪ੍ਰਮਾਣਿਤ ਕੀਤੀ ਗਈ ਸੀ। ਸੈਂਸਰਾਂ ਦੀ ਗਤੀਸ਼ੀਲ ਪ੍ਰਤੀਕਿਰਿਆ ਸੀਮਾ 0 ਅਤੇ 0.6 μg mL-1 ਦੇ ਵਿਚਕਾਰ ਹੈ, ਅਤੇ ਖੋਜ ਦੀ ਸੀਮਾ 0.09 μg mL-1 ਹੈ। ਨਤੀਜਿਆਂ ਨੂੰ ਪੀਟੀਆਈਏ (ਪਾਰਟੀਕਲ ਇਨਹਾਂਸਡ ਇਮਯੂਨੋਟੁਰਬੀਡੀਮੀਟ੍ਰਿਕ ਅਸੇ) ਵਿਧੀ ਨਾਲ ਤੁਲਨਾ ਕਰਕੇ ਪ੍ਰਮਾਣਿਤ ਕੀਤਾ ਗਿਆ ਸੀ ਜੋ ਚੰਗਾ ਸਮਝੌਤਾ ਦਿਖਾ ਰਿਹਾ ਸੀ। ਚਿਕਨ ਅੰਡੇ ਦੇ ਸਫੇਦ cystatin ਜਾਂ Cystatin C ਦਾ ਇੱਕ ਕੈਲੀਬ੍ਰੇਸ਼ਨ ਕਰਵ ਵਰਤਿਆ ਗਿਆ ਸੀ। ਸੰਵੇਦਕ ਸੰਭਾਵੀ ਪ੍ਰਦਰਸ਼ਿਤ ਕਰਨ ਲਈ, ਸਿਸਟੈਟੀਨ ਸੀ ਖੂਨ ਦੇ ਪਲਾਜ਼ਮਾ, ਪਿਸ਼ਾਬ ਅਤੇ ਥੁੱਕ ਵਿੱਚ ਨਿਰਧਾਰਤ ਕੀਤਾ ਗਿਆ ਸੀ, ਸਾਹਿਤ ਵਿੱਚ ਰਿਪੋਰਟ ਕੀਤੇ ਗਏ ਡੇਟਾ ਨਾਲ ਚੰਗੀ ਸਹਿਮਤੀ ਦਿਖਾਉਂਦੇ ਹੋਏ। ਲਿਊਕੇਮੀਆ ਤੋਂ ਪੀੜਤ ਲੋਕਾਂ ਦੇ ਖੂਨ ਦੇ ਪਲਾਜ਼ਮਾ ਵਿੱਚ cystatin ਦੀ ਗਾੜ੍ਹਾਪਣ ਦੇ ਨਤੀਜੇ cystatin ਦੇ ਆਮ ਪੱਧਰ ਤੋਂ ਘੱਟ ਪਾਏ ਗਏ ਸਨ।


ਨਤੀਜੇ ਅਤੇ ਚਰਚਾਵਾਂ

ਇਨਫਲੂਐਂਜ਼ਾ ਏ ਵਾਇਰਸ ਅਤੇ ਸਿਲਿਕਾ ਨੈਨੋਪਾਰਟਿਕਸ ਦੀ SPRM ਇਮੇਜਿੰਗ।

ਚਿੱਤਰ 2 ਵੱਖ-ਵੱਖ ਆਕਾਰ ਦੇ ਸਿਲਿਕਾ ਨੈਨੋਪਾਰਟਿਕਲ ਅਤੇ H1N1 ਇਨਫਲੂਐਂਜ਼ਾ ਏ ਵਾਇਰਸ ਦੀਆਂ SPRM ਤਸਵੀਰਾਂ ਦਿਖਾਉਂਦਾ ਹੈ। ਕਿਉਂਕਿ SPR ਚਿੱਤਰ ਸਤਹ ਸੰਵੇਦਨਸ਼ੀਲ ਹੈ, ਸਿਰਫ ਉਹ ਕਣ ਜੋ ਸਤ੍ਹਾ 'ਤੇ ਜਾਂ ਬਹੁਤ ਨੇੜੇ ਹਨ ਦਿਸਦੇ ਹਨ। ਸਾਹਿਤ (4) ਦੇ ਅਨੁਸਾਰ, ਇਨਫਲੂਐਂਜ਼ਾ ਏ ਵਾਇਰਲ ਕਣਾਂ ਦਾ ਆਕਾਰ 90 ਤੋਂ 110 nm ਤੱਕ ਹੁੰਦਾ ਹੈ। ਸਿਲਿਕਾ ਨੈਨੋਪਾਰਟਿਕਲ ਮਾਈਕ੍ਰੋਸਕੋਪ ਦੀ ਵਿਭਿੰਨਤਾ ਸੀਮਾ ਤੋਂ ਵੀ ਛੋਟੇ ਹੁੰਦੇ ਹਨ ਅਤੇ ਪ੍ਰਸਾਰਣ ਚਿੱਤਰ ਵਿੱਚ ਦਿਖਾਈ ਨਹੀਂ ਦਿੰਦੇ ਹਨ। ਵਾਇਰਲ ਅਤੇ ਸਿਲਿਕਾ ਨੈਨੋਪਾਰਟਿਕਲ ਦੋਵਾਂ ਦੇ SPR ਚਿੱਤਰਾਂ ਨੂੰ ਇੱਕ ਦਿਲਚਸਪ V- ਆਕਾਰ ਦੇ ਵਿਭਿੰਨ ਪੈਟਰਨ ਦੇ ਨਾਲ ਚਮਕਦਾਰ ਚਟਾਕ ਵਜੋਂ ਦਿਖਾਇਆ ਗਿਆ ਹੈ। ਇਹ ਪੈਟਰਨ ਨੈਨੋ ਕਣਾਂ ਦੁਆਰਾ ਸਤਹ ਪਲਾਜ਼ਮੋਨ ਤਰੰਗਾਂ ਦੇ ਖਿੰਡੇ ਜਾਣ ਕਾਰਨ ਹੈ, ਜਿਸ ਬਾਰੇ ਬਾਅਦ ਵਿੱਚ ਵਿਸਥਾਰ ਵਿੱਚ ਚਰਚਾ ਕੀਤੀ ਜਾਵੇਗੀ।

() PBS ਬਫਰ ਵਿੱਚ H1N1 ਇਨਫਲੂਐਂਜ਼ਾ A ਵਾਇਰਸ ਅਤੇ ਤਿੰਨ ਵੱਖ-ਵੱਖ ਆਕਾਰ ਦੇ ਸਿਲਿਕਾ ਨੈਨੋਪਾਰਟਿਕਲ ਦੇ SPRM ਚਿੱਤਰ। (ਇਨਸੈਟਸ) ਸੰਖਿਆਤਮਕ ਸਿਮੂਲੇਸ਼ਨ ਦੁਆਰਾ ਤਿਆਰ ਕੀਤੇ ਨੈਨੋਪਾਰਟਿਕਲ ਚਿੱਤਰ। (ਬੀ ਅਤੇ ਸੀ) X ਅਤੇ Y ਦਿਸ਼ਾਵਾਂ ਦੇ ਨਾਲ ਚੁਣੇ ਹੋਏ ਕਣਾਂ ਦੇ SPR ਤੀਬਰਤਾ ਪ੍ਰੋਫਾਈਲ (ਵਿੱਚ ਡੈਸ਼ਡ ਲਾਈਨਾਂ ਦੁਆਰਾ ਦਰਸਾਏ ਗਏ , ਕ੍ਰਮਵਾਰ. (ਇਨਸੈਟਸ) ਸਿਮੂਲੇਟ ਚਿੱਤਰਾਂ ਤੋਂ ਅਨੁਸਾਰੀ ਪ੍ਰੋਫਾਈਲ।

ਸਥਾਨਿਕ ਰੈਜ਼ੋਲਿਊਸ਼ਨ।

ਚਿੱਤਰ 2 ਬੀ ਅਤੇ ਸੀ ਕ੍ਰਮਵਾਰ (ਚਿੱਤਰ 2 ਵਿੱਚ ਡੈਸ਼ਡ ਲਾਈਨਾਂ ਦੁਆਰਾ ਚਿੰਨ੍ਹਿਤ) ਸਤਹ ਪਲਾਜ਼ਮੋਨ ਪ੍ਰਸਾਰ ਦਿਸ਼ਾ ਦੇ ਨਾਲ (Y) ਅਤੇ (X) ਦੇ ਨਾਲ, ਚੁਣੇ ਗਏ ਵਾਇਰਲ ਅਤੇ ਸਿਲਿਕਾ ਨੈਨੋਪਾਰਟਿਕਲ ਦੇ ਚਿੱਤਰ ਤੀਬਰਤਾ ਪ੍ਰੋਫਾਈਲਾਂ ਨੂੰ ਦਿਖਾਉਂਦਾ ਹੈ). ਕਣਾਂ ਦੇ ਆਕਾਰ ਦੇ ਬਾਵਜੂਦ, ਲੰਬਕਾਰੀ ਦਿਸ਼ਾ ਪ੍ਰੋਫਾਈਲ ਲਗਭਗ 0.5 μm ਦੇ ਅੱਧੇ ਅਧਿਕਤਮ (FWHM) 'ਤੇ ਪੂਰੀ ਚੌੜਾਈ ਦਿਖਾਉਂਦੇ ਹਨ, ਜੋ ਕਿ ਆਪਟੀਕਲ ਵਿਭਿੰਨਤਾ ਸੀਮਾ ਦੇ ਕਾਰਨ ਹੈ। 632 nm ਲੇਜ਼ਰ ਅਤੇ NA 1.65 ਉਦੇਸ਼ ਦੇ ਨਾਲ ਮਾਈਕ੍ਰੋਸਕੋਪ ਦੀ ਸਿਧਾਂਤਕ ਵਿਭਿੰਨਤਾ ਸੀਮਾ 0.23 μm ਹੈ, ਅਤੇ ਦੋ ਸੰਖਿਆਵਾਂ ਵਿੱਚ ਅੰਤਰ ਹੈ ਕਿਉਂਕਿ ਘਟਨਾ ਲੇਜ਼ਰ ਬੀਮ ਸਾਡੇ ਸੈੱਟਅੱਪ ਵਿੱਚ ਉਦੇਸ਼ ਦੇ ਪੂਰੇ ਅਪਰਚਰ ਨੂੰ ਪੂਰੀ ਤਰ੍ਹਾਂ ਕਵਰ ਨਹੀਂ ਕਰਦੀ, ਨਤੀਜੇ ਵਜੋਂ ਇੱਕ ਛੋਟਾ ਪ੍ਰਭਾਵਸ਼ਾਲੀ ਸੰਖਿਆਤਮਕ ਅਪਰਚਰ (ਚਿੱਤਰ 1)। ਸਤਹ ਪਲਾਜ਼ਮੋਨ ਪ੍ਰਸਾਰ ਦਿਸ਼ਾ ਦੇ ਨਾਲ ਤੀਬਰਤਾ ਪ੍ਰੋਫਾਈਲ ਦੱਸਦੀ ਹੈ ਕਿ ਤੀਬਰਤਾ ਲਗਭਗ 3 μm ਦੀ ਸੜਨ ਵਾਲੀ ਲੰਬਾਈ ਦੇ ਨਾਲ ਖਰਾਬ ਹੋ ਜਾਂਦੀ ਹੈ। ਤੀਬਰਤਾ ਸੜਨ ਸਤਹ ਪਲਾਜ਼ਮੋਨ ਤਰੰਗਾਂ ਦੀ ਸੀਮਤ ਪ੍ਰਸਾਰ ਦੀ ਲੰਬਾਈ ਨੂੰ ਮਾਪਦੀ ਹੈ (ਚਿੱਤਰ 2ਸੀ), ਜੋ ਕਿ ਧਾਤ ਦੀ ਕਿਸਮ ਅਤੇ ਘਟਨਾ ਪ੍ਰਕਾਸ਼ ਦੀ ਤਰੰਗ ਲੰਬਾਈ 'ਤੇ ਨਿਰਭਰ ਕਰਦਾ ਹੈ। ਉਦਾਹਰਨ ਲਈ, ਜੇਕਰ 532 nm ਰੋਸ਼ਨੀ ਦੀ ਵਰਤੋਂ ਕੀਤੀ ਜਾਂਦੀ ਹੈ, ਤਾਂ ਪ੍ਰਸਾਰ ਦੀ ਲੰਬਾਈ ਪਾਣੀ ਵਿੱਚ ਸੋਨੇ ਲਈ ਲਗਭਗ 0.2 μm ਤੱਕ ਘਟਾ ਦਿੱਤੀ ਜਾਂਦੀ ਹੈ, ਵਿਭਿੰਨਤਾ ਸੀਮਾ (16) ਦੇ ਨੇੜੇ। ਆਪਟੀਕਲ ਸਿਸਟਮ ਦੇ ਦਖਲਅੰਦਾਜ਼ੀ ਪੈਟਰਨਾਂ ਦੇ ਕਾਰਨ ਹੋਣ ਵਾਲੀ ਤੀਬਰਤਾ ਵਿੱਚ ਦੋਨਾਂ ਨੂੰ ਅਕਸਰ ਦੇਖਿਆ ਜਾਂਦਾ ਹੈ, ਪਰ ਉਹ ਮਾਈਕ੍ਰੋਸਕੋਪ x ਜਾਂ y ਅਨੁਵਾਦ ਨਾਲ ਨਹੀਂ ਚਲਦੇ ਅਤੇ ਅਸਲ ਨਮੂਨੇ ਦੀਆਂ ਵਿਸ਼ੇਸ਼ਤਾਵਾਂ ਤੋਂ ਆਸਾਨੀ ਨਾਲ ਵੱਖ ਕੀਤੇ ਜਾ ਸਕਦੇ ਹਨ।

SPRM ਪ੍ਰਯੋਗ ਸੈੱਟਅੱਪ ਦੀ ਯੋਜਨਾਬੱਧ (ਡਰਾਇੰਗ ਨਾ ਸਕੇਲ ਕਰਨ ਲਈ)। ਸੈੱਟਅੱਪ ਦਾ ਵਿਸਤ੍ਰਿਤ ਵੇਰਵਾ ਵਿੱਚ ਪਾਇਆ ਜਾ ਸਕਦਾ ਹੈ ਸਮੱਗਰੀ ਅਤੇ ਢੰਗ.

ਵਿਭਿੰਨਤਾ ਪੈਟਰਨ।

ਵਿਅਕਤੀਗਤ ਕਣਾਂ ਨਾਲ ਜੁੜੇ ਵਿਭਿੰਨ ਪੈਟਰਨ ਸਾਡੇ ਲਈ ਬੈਕਗ੍ਰਾਉਂਡ ਸ਼ੋਰ ਅਤੇ ਦਖਲਅੰਦਾਜ਼ੀ ਪੈਟਰਨਾਂ ਤੋਂ ਨੈਨੋ ਕਣਾਂ ਦੀ ਪਛਾਣ ਕਰਨ ਵਿੱਚ ਮਦਦਗਾਰ ਹੁੰਦੇ ਹਨ। ਨੈਨੋ ਕਣਾਂ ਦੇ ਸੰਖਿਆਤਮਕ ਤੌਰ 'ਤੇ ਸਿਮੂਲੇਟਡ SPRM ਚਿੱਤਰ (ਚਿੱਤਰ 2 ਇਨਸੈਟਸ) ਪੁਸ਼ਟੀ ਕਰਦੇ ਹਨ ਕਿ ਪੈਟਰਨ ਸਤਹ ਪਲਾਜ਼ਮੋਨ ਤਰੰਗਾਂ ਦੇ ਨੈਨੋਪਾਰਟਿਕਲ-ਪ੍ਰੇਰਿਤ ਸਕੈਟਰਿੰਗ ਦੇ ਕਾਰਨ ਹਨ। ਗਣਨਾ ਕੀਤੀ ਲਾਈਨ ਪ੍ਰੋਫਾਈਲ (ਚਿੱਤਰ 2 ਬੀ ਅਤੇ ਸੀ ਇਨਸੈਟਸ) ਮਾਪਿਆ ਪ੍ਰੋਫਾਈਲਾਂ ਨਾਲ ਚੰਗੀ ਤਰ੍ਹਾਂ ਮੇਲ ਖਾਂਦਾ ਹੈ। ਇਸ ਤੋਂ ਇਲਾਵਾ, ਵਿਭਿੰਨਤਾ ਪੈਟਰਨ ਦੀ ਗਣਨਾ ਕੀਤੀ ਸਿਖਰ ਤੀਬਰਤਾ ਕਣ ਦੇ ਆਕਾਰ ਦੇ ਨਾਲ ਵਧਦੀ ਹੈ, ਜੋ ਪ੍ਰਯੋਗਾਤਮਕ ਡੇਟਾ ਦੇ ਨਾਲ ਵੀ ਸਹਿਮਤ ਹੈ।

ਵਾਇਰਸ-ਸਤਹ ਪਰਸਪਰ ਪ੍ਰਭਾਵ।

ਸਮੇਂ ਦੇ ਨਾਲ ਕਣਾਂ ਦੇ ਚਿੱਤਰਾਂ ਨੂੰ ਟਰੈਕ ਕਰਕੇ, ਅਸੀਂ ਵੱਖ-ਵੱਖ ਕਿਸਮਾਂ ਦੇ ਵਾਇਰਸ-ਸਤਹ ਦੇ ਪਰਸਪਰ ਪ੍ਰਭਾਵ ਨੂੰ ਵੱਖ ਕਰ ਸਕਦੇ ਹਾਂ। ਅਸੀਂ ਤਿੰਨ ਵੱਖ-ਵੱਖ ਸਤਹਾਂ 'ਤੇ ਇਨਫਲੂਐਂਜ਼ਾ ਵਾਇਰਸ ਦੀਆਂ SPRM ਤਸਵੀਰਾਂ ਪ੍ਰਾਪਤ ਕੀਤੀਆਂ: ਬੇਅਰ ਗੋਲਡ, ਪੀਈਜੀ-ਫੰਕਸ਼ਨਲਾਈਜ਼ਡ ਸਤਹ, ਅਤੇ ਐਂਟੀਇਨਫਲੂਏਂਜ਼ਾ ਫੰਕਸ਼ਨਲਾਈਜ਼ਡ ਸਤਹ। ਚਿੱਤਰ 3 ਸੋਨੇ 'ਤੇ ਇਨਫਲੂਐਂਜ਼ਾ A ਕਣਾਂ ਦੇ SPRM ਚਿੱਤਰਾਂ ਦਾ ਸਮਾਂ ਕ੍ਰਮ ਦਿਖਾਉਂਦਾ ਹੈ। ਇਸ ਲੜੀ ਦਾ ਇੱਕ ਵੀਡੀਓ (ਮੂਵੀ S1) ਉਪਲਬਧ ਹੈ। ਵਾਇਰਲ ਕਣਾਂ ਦਾ ਸੋਨੇ ਦੀ ਸਤ੍ਹਾ ਨਾਲ ਚਿਪਕਣਾ ਵਾਇਰਲ ਘੋਲ ਨੂੰ ਬਫਰ ਘੋਲ ਵਿੱਚ ਸਪਾਈਕ ਕਰਨ ਤੋਂ ਬਾਅਦ ਦੇਖਿਆ ਜਾ ਸਕਦਾ ਹੈ। ਇਸ ਦੇ ਉਲਟ, ਸਿਲਿਕਾ ਨੈਨੋਪਾਰਟਿਕਲ ਸਤ੍ਹਾ 'ਤੇ ਚਿਪਕਦੇ ਨਹੀਂ ਹਨ, ਅਤੇ ਉਹ ਬ੍ਰਾਊਨੀਅਨ ਮੋਸ਼ਨ ਦੇ ਕਾਰਨ ਚਿੱਤਰ ਤੋਂ ਦਿਖਾਈ ਦਿੰਦੇ ਹਨ ਅਤੇ ਅਲੋਪ ਹੋ ਜਾਂਦੇ ਹਨ (ਦੇਖੋ ਮੂਵੀ S2)।

ਨੰਗੇ ਸੋਨੇ 'ਤੇ ਇਨਫਲੂਐਂਜ਼ਾ ਏ ਵਾਇਰਸ ਦੀਆਂ SPRM ਤਸਵੀਰਾਂ। () ਇਨਫਲੂਐਂਜ਼ਾ ਵਾਇਰਸ ਦਾ SPRM ਚਿੱਤਰ ਕ੍ਰਮ। ਰੰਗ ਦਾ ਨਕਸ਼ਾ mDeg ਵਿੱਚ ਸੰਬੰਧਿਤ SPR ਚਿੱਤਰ ਤੀਬਰਤਾ ਦਿਖਾਉਂਦਾ ਹੈ। (ਬੀ) ਸਮੇਂ ਦੇ ਨਾਲ SPR ਦੀ ਤੀਬਰਤਾ ਉਹਨਾਂ ਖੇਤਰਾਂ (ਚਿੱਤਰਾਂ ਦੁਆਰਾ ਦਰਸਾਈ ਗਈ) ਵਿੱਚ ਬਦਲਦੀ ਹੈ ਜਿੱਥੇ ਵਿਅਕਤੀਗਤ ਵਾਇਰਲ ਕਣ ਸੋਨੇ ਦੀ ਸਤਹ 'ਤੇ ਸੋਖਦੇ ਹਨ।

ਚਿੱਤਰ 3ਬੀ ਤਿੰਨ ਪ੍ਰਤੀਨਿਧ ਵਾਇਰਲ ਕਣਾਂ ਦੀ ਔਸਤ ਤੀਬਰਤਾ ਦਿਖਾਉਂਦਾ ਹੈ (ਚਿੱਤਰ 3 ਵਿੱਚ ਡੈਸ਼ਡ ਲਾਈਨ ਆਇਤ ਵਜੋਂ ਦਿਖਾਇਆ ਗਿਆ ਹੈ।) ਇੱਕ ਨੰਗੇ ਸੋਨੇ ਦੀ ਸਤਹ 'ਤੇ ਸਮੇਂ ਦੇ ਨਾਲ. SPRM ਚਿੱਤਰ ਵਿੱਚ ਵਾਇਰਲ ਕਣ ਦਿਖਾਈ ਦੇਣ ਵਾਲੇ ਪਲਾਂ ਨੂੰ ਤੀਰਾਂ ਨਾਲ ਦਰਸਾਇਆ ਗਿਆ ਹੈ। ਇੱਕ ਵਾਰ ਜਦੋਂ ਕੋਈ ਵਾਇਰਲ ਕਣ ਸਤ੍ਹਾ 'ਤੇ ਆ ਜਾਂਦਾ ਹੈ, ਤਾਂ ਇਹ ਸਤ੍ਹਾ 'ਤੇ ਰਹਿੰਦਾ ਹੈ, ਜੋ ਸੋਨੇ 'ਤੇ ਵਾਇਰਲ ਕਣਾਂ ਦੀ ਮਜ਼ਬੂਤ ​​ਅਤੇ ਅਟੱਲ ਗੈਰ-ਵਿਸ਼ੇਸ਼ ਸੋਸ਼ਣ ਨੂੰ ਦਰਸਾਉਂਦਾ ਹੈ।

ਇਸਦੇ ਉਲਟ, ਵਾਇਰਸ ਪੀਈਜੀ ਅਤੇ ਐਂਟੀਬਾਡੀ-ਕੋਟੇਡ ਸਤਹਾਂ 'ਤੇ ਬਿਲਕੁਲ ਵੱਖਰੇ ਤਰੀਕੇ ਨਾਲ ਵਿਵਹਾਰ ਕਰਦਾ ਹੈ। ਚਿੱਤਰ 4 ਦੋ ਸਤਹਾਂ 'ਤੇ ਵਿਅਕਤੀਗਤ ਇਨਫਲੂਐਂਜ਼ਾ ਏ ਵਾਇਰਲ ਕਣਾਂ ਲਈ ਸਮੇਂ ਦੇ ਨਾਲ ਖਾਸ SPRM ਤੀਬਰਤਾ ਪ੍ਰੋਫਾਈਲ ਦਿਖਾਉਂਦਾ ਹੈ। On the PEG-functionalized surface, the individual viral particles are imaged only as transient events—they appear and disappear rapidly, which is completely different from the behavior on the bare gold surface. This observation is expected because PEG coating is well known for its capability to block nonspecific binding of biomolecules to surfaces. The transient appearance and disappearance of the viral particles on the PEG-coated surface is due to Brownian motion. On the antibody-functionalized surface, the behavior of the viral particles is in between the two limits described above. We observed that individual viral particles tended to stay on the surface for much longer time than on the PEG-coated surface, but they eventually leave the surface. This observation can be attributed to a reversible binding of the viral particles to the antibody-coated surface.

() SPR intensity vs. time profiles for influenza A viral particles on PEG and antiinfluenza A antibody-functionalized surfaces. (ਬੀ) Histogram showing relative binding probabilities of influenza A on PEG and antiinfluenza A antibody-functionalized surfaces. The analysis of control experiment, HCMV on antiinfluenza A antibody-functionalized surfaces, is also shown for comparison. Note the vertical axis of the histogram is the probability of a particle stays on the surface (determined from the time profiles similar to ).

By tracking the individual viral particles in the SPRM image over time, we obtain the probabilities of individual influenza particles staying on the PEG and antiinfluenza-coated surfaces (Fig. 4ਬੀ). For comparison, the statistical analysis of human cytomegalovirus (HCMV) on the antiinfluenza antibody-coated surface is also plotted in Fig. 4ਬੀ. The histogram clearly shows that the specific binding of influenza A on the antibody-coated surface is significantly higher than the nonspecific bindings in the two control experiments, influenza A on the control PEG surface and the control virus, HCMV, on the antibody surface.

The single virus detection with our SPRM was carried out in a static solution, but the findings are consistent with those obtained with the conventional flow-through SPR measurement using samples with the same concentrations (Fig. S1). For example, the injection of 0.1 ml of 0.05 mg/ml influenza A solutions at a flow rate of 30 μl/ min resulted in a large irreversible binding of the virus on the bare gold chip, which is due to strong nonspecific interactions between influenza A and gold surface. On a PEG-functionalized chip, no virus binding was detected by the flow-through SPR. On an antibody-coated chip, approximately 45 mDeg SPR angular shift was observed, which is in between the two extremes. Finally, the flow-through SPR detected no significant binding of HCMV (0.25 mg/ml) onto the antiinfluenza A-coated chip.

Quantitative Analysis of Influenza A Size and Mass.

Mass is a fundamental physical parameter of substances, and precise measurement of mass is one of the most important analytical methods, such as mass spectroscopy (17). A widely used method to measure virus mass is based on ultracentrifugation, which determines the averaged mass of virus in a sample from density gradient sedimentation (18, 19). SPR measures the optical mass of each viral particle, which is directly related to the inertia mass of the particle. To determine the mass of influenza virus, we used silica nanoparticles with a refractive index of 1.46 as calibration standard. The refractive index of influenza based on its protein and lipid contents is approximately 1.48, close to that of the silica nanoparticles. Dry influenza consists of 70 to 75% proteins and 20 to 24% lipids (20), and the mass density of hydrated influenza virus is 1.19 g/ml (20, 21). At such a mass density, the refractive index of a protein solution is 1.48 (22), and the refractive index of lipids is similar (23). Based on these considerations, the refractive index of influenza virus was taken to be 1.48.

We measured the intensities of the individual nanoparticles from the SPRM images and constructed histograms for silica nanoparticles and influenza viral particles (Fig. 5). The histograms of the silica nanoparticles can be approximately fit with Gaussian distributions, but a small peak appears at an intensity twice of the main peak in each histogram (arrows in Fig. 5). We attributed it to the formation of nanoparticle dimers. Fig. 5ਬੀ plots the relative SPRM intensity at the peak of each histogram vs. silica nanoparticle volume determined from the size and density provided by the manufacturers for each particle sample (Table S1). The intensity of a nanoparticle is expected to be proportional to the volume of the particle exposed in the evanescent field associated with the propagating surface plamsons. By considering that the evanescent field decays exponentially with distance from the surface, we express the intensity with [1] where k is a constant (fitting parameter), z is distance above the gold surface, ਆਰ is radius of the particle, and l is the decay constant of the evanescent field, which is approximately 200 nm. Eq. 1 provides a good fit to the experimental data shown in Fig. 5ਬੀ (solid line).

() Histograms of relative SPR intensity distributions of individual silica nanoparticles and influenza A viral particles. The solid red lines are Gaussian fittings of the distributions. Arrows indicate peaks that are likely due to the formation of dimmers. (ਬੀ) Calibration curve of SPR intensity plotted vs. particle volumes. The average volume of an influenza particle is obtained from the calibration curve and the average SPR intensity in the histogram plotted in A. The vertical error bars are standard deviations of the Gaussian fittings of the histograms of the SPR intensities. The horizontal error bars for the silica nanoparticles are standard deviations calculated from the coefficient of variation of particle diameter given by the manufacturers, and the horizontal error bars for the influenza are estimated from the standard deviation of the volume extracted from the SPR intensity.

From the calibration curve shown in Fig. 5ਬੀ and the histogram in Fig. 5, the volume and diameter of influenza A were found to be 6.8 ± 3.0 × 10 -4 μm 3 and 109 ± 13 nm, respectively. Given that the mass density of influenza A is 1.19 g/ml (19), the mass of influenza A virus was determined to be 0.80 ± 0.35 fg, which is in good agreement with the literature values (4, 20, 21) (see SI Appendix for details).

Using the same method, we also obtained the histogram of SPRM image intensity for HCMV viral particles (Fig. S2). Using the calibration curve in Fig. 5ਬੀ, we find that the average volume and diameter of a HCMV viron are 5.4 ± 0.7 × 10 -3 μm 3 and 218 ± 10 nm (assuming the refractive index of HCMV is 1.48), respectively, which are in consistent with the literature (approximately 230 nm diameter) (24). Using a reported density of 1.219 g/ml (25), we calculated that the mass of each HCMV viron is 6.5 ± 0.8 fg.

Detection Limit.

Fig. S3 shows the noise level of current setup. The noise level for an area covering a single particle image (∼3 × 5 μm) is 0.3 mDeg. Most SPR detections have time resolution of about one second. Using a one-second moving average, we can reduce the noise to 0.04 mDeg. This noise level, according to the calibration curve in Fig. 5, can detect 13 nm nanoparticles, corresponding to a detectable mass of approximately 1 × 10 -18 g (1 ag).

A more useful way to define the detection limit is detectable mass per unit sensing area, because it is directly related to the detectable analyte concentration in solution, an important quantity for most applications. This detection limit definition also allows one to compare sensors with different sensing areas. For instance, a small sensor may have a lower total mass detection limit, but its small sensing area makes it less likely to detect the analyte molecules. For our current SPRM setup, the entire image area is the sensing area, which is 0.08 × 0.06 mm 2 , so the binding of a single particle with mass as small as 1 ag on the sensing area can be detected. In terms of mass per unit area, the achieved detection limit is 0.2 fg/mm 2 , which is nearly four orders of magnitude better than the typical detection limit of the conventional SPR (15). This improved detection limit is provided by our capability of imaging single viral particles, which allows us to average signals in the regions of viral particles only so that noises in all other regions do not affect the signals of the particles. We note that further improvement in the detection limit may be achieved by using less noisy light source and CCD and by reducing mechanical vibrations of the system.


Biophysics uses biophysical instrumentation to characterize macromolecules in solution and study molecular interactions. The platform uses mass spectrometry for protein identification and small molecule identification and quantification and performs quality control of recombinant proteins for optimized data quality in downstream applications.

The platform ensures proper instrument function with routine maintenance and checks for high standards of performance.

As an active member of the ARBRE-MOBIEU EU network, a cluster of biophysics facilities across Europe, the platform contributes to improving information exchange, development and evaluation of new technologies.

  • State of the art instrumentation UV-VIS spectrophotometer: Protein/nucleic acid quantification. Enzyme kinetics.
  • Circular Dichroism (CD): Information about secondary structure and protein stability.
  • Fluorescence Spectroscopy (FS): Binding studies.
  • Differential Scanning Fluorimetry (DSF): Thermal stability of globular proteins. Protein quality controls (optimal buffers for downstream applications, storage conditions).
  • Dynamic Light Scattering (DLS): Sizes and distributions of biomolecules in solution.
  • Size Exclusion Chromatography coupled to Multi-Angle Light Scattering (SEC-MALS): Absolute molar mass determination.
  • MicroScale Thermophoresis (MST): Measurement of binding interactions.
  • Isothermal Titration Calorimetry (ITC): Thermodynamic technique to study different binding events.
  • Surface Plasmon Resonance (SPR): Measurement of biomolecular interactions in real time.Provides kinetic information (k'ਤੇ ਅਤੇ ਕੇoff rates). Screening of low molecular weight analytes.
  • Mass spectrometer (ESI-TOF MS).: Protein identification. Small molecule identification and quantification.