ਜਾਣਕਾਰੀ

ਕਰਾਸ-ਸਪੀਸੀਜ਼ ਲਾਗ

ਕਰਾਸ-ਸਪੀਸੀਜ਼ ਲਾਗ



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

ਮੈਂ ਸੁਣਿਆ ਹੈ ਕਿ HIV SIV ਆਦਿ ਤੋਂ ਵਿਕਸਿਤ ਹੋਇਆ ਹੈ।

ਮੈਂ ਇਹ ਵੀ ਸੁਣਿਆ ਹੈ ਕਿ ਜ਼ਿਆਦਾਤਰ ਸਪੀਸੀਜ਼ (ਜ਼ਿਆਦਾਤਰ ਬਾਂਦਰਾਂ ਸਮੇਤ) ਨੂੰ ਮਨੁੱਖਾਂ ਵਾਂਗ ਆਮ ਜ਼ੁਕਾਮ ਨਹੀਂ ਹੋ ਸਕਦਾ।

ਤਾਂ ਫਿਰ ਕੀ ਕਾਰਨ ਹੈ ਕਿ ਲਾਗਾਂ ਸਪੀਸੀਜ਼ ਵਿੱਚ ਯਾਤਰਾ ਕਰਨ ਦੇ ਯੋਗ ਹੋਣ, ਜਾਂ ਇਸਦੇ ਉਲਟ?

ਸਵਾਲ ਦੀ ਖ਼ਾਤਰ, ਮੈਂ ਦਾਇਰਾ ਸੀਮਤ ਕਰਾਂਗਾ। ਮੰਨ ਲਓ ਕਿ ਸਾਡੇ ਕੋਲ ਇੱਕ ਵਾਇਰਸ ਹੈ ਜੋ ਮਨੁੱਖਾਂ ਨੂੰ ਸੰਕਰਮਿਤ ਕਰ ਸਕਦਾ ਹੈ ਪਰ ਨਜ਼ਦੀਕੀ ਮਨੁੱਖੀ ਰਿਸ਼ਤੇਦਾਰਾਂ ਨੂੰ ਸੰਕਰਮਿਤ ਨਹੀਂ ਕਰ ਸਕਦਾ, ਜਿਵੇਂ ਕਿ ਚਿੰਪੈਂਜ਼ੀ। ਉਸ ਵਾਇਰਸ ਦੇ ਜੀਵ ਵਿਗਿਆਨ ਜਾਂ ਜਾਨਵਰਾਂ ਦੇ ਜੀਵ-ਵਿਗਿਆਨ ਬਾਰੇ ਕੀ ਇਸ ਅੰਤਰ ਦਾ ਕਾਰਨ ਬਣਦਾ ਹੈ?

ਮੈਂ ਜਾਣਦਾ ਹਾਂ ਕਿ ਕੁਝ ਜਾਨਵਰਾਂ ਦੇ ਨਾਲ ਇਹ ਸਰੀਰ ਦੇ ਤਾਪਮਾਨ ਜਾਂ ਚਮੜੀ ਦੀ ਬਣਤਰ ਆਦਿ ਬਾਰੇ ਹੈ। ਪਰ ਮਨੁੱਖ ਅਤੇ ਚਿੰਪਸ ਸਰੀਰਕ ਤੌਰ 'ਤੇ ਬਹੁਤ ਸਮਾਨ ਹਨ। ਕੀ ਇਹ ਸਭ ਇਮਿਊਨ ਫਰਕ ਬਾਰੇ ਹੈ?


ਵਾਇਰਸ ਆਪਣੇ ਮੇਜ਼ਬਾਨਾਂ ਦੇ ਨਾਲ-ਨਾਲ ਵਿਕਸਿਤ ਹੁੰਦੇ ਹਨ। ਜੇਕਰ ਤੁਸੀਂ ਮੇਲ ਖਾਂਦੇ ਚਿੰਪ ਕ੍ਰੋਮੋਸੋਮ ਲਈ ਇੱਕ ਮਨੁੱਖੀ ਕ੍ਰੋਮੋਸੋਮ ਨੂੰ ਇੱਕ ਚਿੰਪ ਸੈੱਲ ਵਿੱਚ ਬਦਲਦੇ ਹੋ, ਤਾਂ ਬਹੁਤ ਸਾਰੀਆਂ ਜੈਨੇਟਿਕ ਸਮਾਨਤਾਵਾਂ ਹੋਣਗੀਆਂ ਪਰ ਤੁਸੀਂ ਅਸੰਗਤਤਾਵਾਂ ਦਾ ਇੱਕ ਸਮੂਹ ਵੀ ਦਿਖਾਓਗੇ ਕਿਉਂਕਿ ਹਰੇਕ ਕ੍ਰੋਮੋਸੋਮ ਦੇ ਜੀਨ ਬਾਕੀ ਜੀਨੋਮ ਤੋਂ ਸੁਤੰਤਰ ਤੌਰ 'ਤੇ ਵਿਕਸਤ ਹੋ ਰਹੇ ਹਨ।

ਵਾਇਰਸ ਕਈ ਪੜਾਵਾਂ 'ਤੇ ਆਪਣੇ ਹੋਸਟ ਜੀਨੋਮ ਨਾਲ ਗੱਲਬਾਤ ਕਰਦੇ ਹਨ। ਪਹਿਲਾਂ, ਉਹਨਾਂ ਨੂੰ ਵਾਤਾਵਰਣ ਵਿੱਚ ਆਪਣੇ ਨਿਸ਼ਾਨੇ ਵਾਲੇ ਮੇਜ਼ਬਾਨਾਂ (ਸੈੱਲਾਂ) ਦੀ ਪਛਾਣ ਕਰਨ ਅਤੇ ਸੈੱਲਾਂ ਤੱਕ ਪਹੁੰਚ ਪ੍ਰਾਪਤ ਕਰਨ ਲਈ ਇੱਕ ਤਰੀਕੇ ਦੀ ਲੋੜ ਹੁੰਦੀ ਹੈ। ਉਹ ਸੈੱਲ ਸਤ੍ਹਾ 'ਤੇ ਮਾਰਕਰ ਨੂੰ ਪਛਾਣ ਕੇ ਅਜਿਹਾ ਕਰਦੇ ਹਨ। HIV ਵਰਗੀ ਕਿਸੇ ਚੀਜ਼ ਲਈ, ਇਹ ਪਛਾਣ ਸਿਰਫ਼ ਮਨੁੱਖਾਂ ਦੀ ਪਛਾਣ ਕਰਨ ਨਾਲੋਂ ਕਿਤੇ ਜ਼ਿਆਦਾ ਖਾਸ ਹੈ: ਉਹ ਖਾਸ ਇਮਿਊਨ ਸੈੱਲਾਂ ਦੀ ਪਛਾਣ ਕਰ ਰਹੇ ਹਨ।

ਇੱਕ ਵਾਰ ਅੰਦਰ, ਵਾਇਰਸ ਵਾਇਰਲ ਜੀਨਾਂ ਨੂੰ ਪ੍ਰਗਟ ਕਰਨ ਲਈ ਹੋਸਟ ਨਾਲ ਗੱਲਬਾਤ ਕਰਦੇ ਹਨ, ਨਵੇਂ ਵਾਇਰਸਾਂ ਨੂੰ ਪੈਦਾ ਕਰਦੇ ਹਨ ਅਤੇ ਇਕੱਠੇ ਕਰਦੇ ਹਨ, ਅਤੇ ਬਾਅਦ ਦੇ ਮੇਜ਼ਬਾਨਾਂ ਨੂੰ ਸੰਚਾਰਿਤ ਕਰਦੇ ਹਨ। ਜੇਕਰ ਇਹਨਾਂ ਵਿੱਚੋਂ ਕਿਸੇ ਵੀ ਪੜਾਅ 'ਤੇ ਅਸੰਗਤਤਾ ਹੁੰਦੀ ਹੈ, ਤਾਂ ਵਾਇਰਸ ਦੁਹਰਾਉਣ ਦੇ ਯੋਗ ਨਹੀਂ ਹੋਵੇਗਾ।

ਹਾਲਾਂਕਿ, ਕਿਉਂਕਿ ਸੰਬੰਧਿਤ ਸਪੀਸੀਜ਼ ਵਿੱਚ ਬਹੁਤ ਸਾਰੀ ਸਮਰੂਪਤਾ ਹੈ, ਇੱਕ ਵਾਇਰਸ ਲਈ ਇੱਕ ਤੋਂ ਵੱਧ ਮੇਜ਼ਬਾਨਾਂ ਨੂੰ ਸੰਕਰਮਿਤ ਕਰਨਾ ਸੰਭਵ ਹੈ। ਜੇਕਰ ਕੋਈ ਵਾਇਰਸ ਅਜਿਹੇ ਸੰਦਰਭ ਵਿੱਚ ਵਿਕਸਤ ਹੁੰਦਾ ਹੈ ਜਿੱਥੇ ਇਹ ਆਮ ਤੌਰ 'ਤੇ ਕਈ ਮੇਜ਼ਬਾਨਾਂ ਨੂੰ ਸੰਕਰਮਿਤ ਕਰਦਾ ਹੈ, ਤਾਂ ਸਾਰੇ ਮੇਜ਼ਬਾਨਾਂ ਵਿੱਚ ਉਹਨਾਂ ਯੋਗਤਾਵਾਂ ਨੂੰ ਬਣਾਈ ਰੱਖਣ ਲਈ ਇਸਦੇ ਲਈ ਚੋਣਵੇਂ ਦਬਾਅ ਹੋ ਸਕਦਾ ਹੈ। ਵਿਕਲਪਕ ਤੌਰ 'ਤੇ, ਚੋਣਵੇਂ ਦਬਾਅ ਕਾਰਨ ਵਾਇਰਸ ਵੱਖ-ਵੱਖ ਵੰਸ਼ਾਂ ਵਿੱਚ ਵਿਕਸਤ ਹੋ ਸਕਦਾ ਹੈ, ਇੱਕ ਸੰਕਰਮਿਤ ਬੱਤਖਾਂ ਅਤੇ ਦੂਜਾ ਸੰਕਰਮਿਤ ਚਿੜੀਆਂ, ਉਦਾਹਰਨ ਲਈ।

ਇੱਕ ਵਾਇਰਸ ਲਈ ਜੋ ਇੱਕ ਖਾਸ ਹੋਸਟ (ਜਾਂ ਮੇਜ਼ਬਾਨਾਂ ਦੀ ਰੇਂਜ) ਲਈ ਖਾਸ ਹੈ, ਇਹ ਸੰਭਾਵਨਾ ਹੈ ਕਿ ਇਸ ਨੂੰ ਉਸ ਸੰਦਰਭ ਤੋਂ ਬਾਹਰ ਕਿਸੇ ਹੋਰ ਮੇਜ਼ਬਾਨ ਵਿੱਚ ਮੁਸ਼ਕਲ ਆਵੇਗੀ ਜਿਸ ਵਿੱਚ ਇਹ ਵਿਕਸਿਤ ਹੋਇਆ ਹੈ। ਹਾਲਾਂਕਿ, ਵਾਇਰਲ ਜੀਨੋਮ ਵਿੱਚ ਵੀ ਪਰਿਵਰਤਨਸ਼ੀਲਤਾ ਹੈ, ਅਤੇ ਜੇਕਰ ਬਹੁਤ ਸਾਰੀਆਂ ਵਾਇਰਲ ਕਾਪੀਆਂ ਇੱਕ ਨਾਵਲ ਹੋਸਟ ਦੇ ਸਾਹਮਣੇ ਆਉਂਦੀਆਂ ਹਨ, ਤਾਂ ਸੰਭਾਵਨਾ ਹੈ ਕਿ ਉਹਨਾਂ ਵਿੱਚੋਂ ਕੁਝ ਉਸ ਮੇਜ਼ਬਾਨ ਵਿੱਚ ਬਚ ਸਕਦੇ ਹਨ। ਇਹ ਉਹਨਾਂ ਖਾਸ ਵਾਇਰਲ ਜੀਨਾਂ ਲਈ ਚੁਣੇਗਾ, ਅਤੇ ਅਗਲੀਆਂ ਵਾਇਰਲ ਪੀੜ੍ਹੀਆਂ ਨੂੰ ਉਹਨਾਂ ਗੁਣਾਂ ਲਈ ਚੁਣਿਆ ਜਾਵੇਗਾ ਜੋ ਉਸ ਮੇਜ਼ਬਾਨ ਵਿੱਚ ਦੁਹਰਾਉਣ ਵਿੱਚ ਮਦਦ ਕਰਦੇ ਹਨ।

ਇਮਿਊਨ ਪ੍ਰਤੀਕ੍ਰਿਆਵਾਂ ਵੀ ਇੱਕ ਭੂਮਿਕਾ ਨਿਭਾ ਸਕਦੀਆਂ ਹਨ, ਪਰ ਜ਼ਿਆਦਾਤਰ ਮਾਮਲਿਆਂ ਵਿੱਚ ਇਹ ਆਪਣੇ ਆਪ ਵਿੱਚ ਵਾਇਰਸਾਂ ਦੀ ਵਿਸ਼ੇਸ਼ਤਾ ਹੁੰਦੀ ਹੈ ਜੋ ਮੇਜ਼ਬਾਨੀ ਦੀ ਵਿਸ਼ੇਸ਼ਤਾ ਦੀ ਕੁੰਜੀ ਰੱਖਦੇ ਹਨ।


Ahlquist, P., Noueiry, A. O., Lee, W. M., Kushner, D. B., & Dye, B. T. (2003)। ਸਕਾਰਾਤਮਕ-ਸਟ੍ਰੈਂਡ ਆਰਐਨਏ ਵਾਇਰਸ ਜੀਨੋਮ ਪ੍ਰਤੀਕ੍ਰਿਤੀ ਵਿੱਚ ਹੋਸਟ ਕਾਰਕ। ਜਰਨਲ ਆਫ਼ ਵਾਇਰੋਲੋਜੀ, 77(15), 8181-8186।

Hao, L., Sakurai, A., Watanabe, T., Sorensen, E., Nidom, C. A., Newton, M. A.,… & Kawaoka, Y. (2008)। ਡਰੋਸੋਫਿਲਾ RNAi ਸਕ੍ਰੀਨ ਇਨਫਲੂਐਂਜ਼ਾ ਵਾਇਰਸ ਪ੍ਰਤੀਕ੍ਰਿਤੀ ਲਈ ਮਹੱਤਵਪੂਰਨ ਹੋਸਟ ਜੀਨਾਂ ਦੀ ਪਛਾਣ ਕਰਦੀ ਹੈ। ਕੁਦਰਤ, 454(7206), 890.

ਸ਼ਿਲਡ, ਜੀ.ਸੀ., ਆਕਸਫੋਰਡ, ਜੇ.ਐਸ., ਡੀ ਜੋਂਗ, ਜੇ.ਸੀ., ਅਤੇ ਵੈਬਸਟਰ, ਆਰ.ਜੀ. (1983)। ਇਨਫਲੂਐਂਜ਼ਾ ਵਾਇਰਸ ਐਂਟੀਜੇਨਿਕ ਰੂਪਾਂ ਦੀ ਹੋਸਟ-ਸੈੱਲ ਚੋਣ ਲਈ ਸਬੂਤ। ਕੁਦਰਤ, 303(5919), 706.


ਵਾਇਰਸਾਂ ਅਤੇ ਉਹਨਾਂ ਦੇ ਮੇਜ਼ਬਾਨਾਂ (ਹੋਰ ਖਾਸ ਤੌਰ 'ਤੇ, ਮੇਜ਼ਬਾਨ ਸੈੱਲ) ਨੂੰ ਸਮਝਣ ਦੀ ਸਭ ਤੋਂ ਵੱਡੀ ਕੁੰਜੀ ਬਾਹਰੀ (ਝਿੱਲੀ ਅਤੇ ECM) ਪ੍ਰੋਟੀਨ ਬਣਤਰ ਹੈ।

ਅੰਗੂਠੇ ਦੇ ਇੱਕ ਆਮ ਨਿਯਮ ਦੇ ਤੌਰ 'ਤੇ, ਵਾਇਰਸਾਂ ਨੂੰ ਉਹਨਾਂ ਦੇ ਮੇਜ਼ਬਾਨ ਸੈੱਲਾਂ ਨੂੰ ਜੋੜਨ ਦੀ ਲੋੜ ਹੁੰਦੀ ਹੈ। ਕੁਝ ਵਾਇਰਸ ਮੇਜ਼ਬਾਨ ਸੈੱਲਾਂ ਨੂੰ "ਉਨ੍ਹਾਂ ਨੂੰ ਖਾਣ" ਅਤੇ ਉਹਨਾਂ ਦੀ ਸਮੱਗਰੀ ਨੂੰ ਚਲਾਉਣ ਲਈ ਟਰਾਂਸਪੋਰਟ ਵਿਧੀ ਦੀ ਦੁਰਵਰਤੋਂ ਕਰਦੇ ਹਨ। ਦੂਜੀਆਂ ਕਿਸਮਾਂ ਦੇ ਵਾਇਰਸਾਂ ਵਿੱਚ ਗੰਦੀ ਦਿੱਖ ਵਾਲੇ ਕਲੈਂਪ ਹੁੰਦੇ ਹਨ (ਸਭ ਤੋਂ ਪ੍ਰਮੁੱਖ ਉਦਾਹਰਨ ਜੋ ਦਿਮਾਗ ਵਿੱਚ ਆਉਂਦੀ ਹੈ ਬੈਕਟੀਰੀਓਫੇਜ ਹਨ) ਜੋ ਮੇਜ਼ਬਾਨ ਸੈੱਲਾਂ ਦੇ ਖਾਸ ਢਾਂਚੇ ਨੂੰ ਫੜ ਲੈਂਦੇ ਹਨ ਜਦੋਂ ਕਿ ਵਾਇਰਸ ਦਾ ਕੇਂਦਰੀ ਟੁਕੜਾ ਮੇਜ਼ਬਾਨ ਸੈੱਲ ਦੀ ਝਿੱਲੀ ਵਿੱਚ ਇੱਕ ਛੇਕ ਮਾਰਦਾ ਹੈ ਤਾਂ ਜੋ ਇਸਨੂੰ ਖਤਰਨਾਕ DNA/RNA ਅਤੇ ਪਾਚਕ.

ਕ੍ਰਾਸ-ਸਪੀਸੀਜ਼ ਇਨਫੈਕਸ਼ਨ ਆਮ ਤੌਰ 'ਤੇ ਕਈ ਪ੍ਰਜਾਤੀਆਂ ਲਈ ਆਮ ਬਣਤਰਾਂ ਦੀ ਦੁਰਵਰਤੋਂ ਕਰਦੀਆਂ ਹਨ। ਉਦਾਹਰਨ ਲਈ, ਸਿਆਲਿਕ ਐਸਿਡ ਰੀਸੈਪਟਰਾਂ ਦੀ ਆਮ ਤੌਰ 'ਤੇ ਵਾਇਰਲ ਐਂਟਰੀ ਪੁਆਇੰਟਾਂ ਵਜੋਂ ਦੁਰਵਰਤੋਂ ਕੀਤੀ ਜਾਂਦੀ ਹੈ (ਵੇਖੋ https://www.ncbi.nlm.nih.gov/pubmed/23873408)। ਜੇਕਰ ਮਨੁੱਖਾਂ ਕੋਲ ਜੀਨੋਮਿਕ ਸਪੋਰਟ ਸੀ ਜਿਵੇਂ ਕੰਪਿਊਟਰ ਓਪਰੇਟਿੰਗ ਸਿਸਟਮ ਕਮਜ਼ੋਰ ਕੰਪੋਨੈਂਟਸ ਲਈ ਅੱਪਡੇਟ ਪ੍ਰਾਪਤ ਕਰਦੇ ਹਨ, ਤਾਂ ਸਿਆਲਿਕ ਐਸਿਡ ਰੀਸੈਪਟਰਾਂ ਨੂੰ ਹਜ਼ਾਰਾਂ ਸਾਲ ਪਹਿਲਾਂ ਇੱਕ ਨਾਜ਼ੁਕ ਜੋਖਮ ਲੇਬਲ ਕੀਤਾ ਗਿਆ ਹੁੰਦਾ ਅਤੇ ਪੈਚ ਕੀਤਾ ਜਾਂਦਾ।

ਸਪੱਸ਼ਟ ਹੈ ਕਿ ਹੋਰ ਕਾਰਕ ਹਨ ਜੋ ਕਰਾਸ-ਸਪੀਸੀਜ਼ ਇਨਫੈਕਸ਼ਨ ਨੂੰ ਰੋਕ ਸਕਦੇ ਹਨ। ਇੱਕ ਸਫਲ ਕਰਾਸ-ਸਪੀਸੀਜ਼ ਵਾਇਰਸ ਨੂੰ ਇਸਦੇ ਮੇਜ਼ਬਾਨਾਂ ਲਈ ਆਮ ਸੈੱਲ ਫੰਕਸ਼ਨਾਂ ਦੇ ਇੱਕ ਘੱਟੋ-ਘੱਟ ਸਮਰਥਿਤ ਓਪਰੇਸ਼ਨ ਸਬਸੈੱਟ ਦੀ ਵਰਤੋਂ ਕਰਨ ਦੀ ਲੋੜ ਹੁੰਦੀ ਹੈ। ਜੇ ਇੱਕ ਸੰਭਾਵੀ (ਬਾਹਰੀ ਬਣਤਰ ਮੇਲ ਦੁਆਰਾ) ਹੋਸਟ ਸੈੱਲ ਵਾਇਰਲ ਪ੍ਰਤੀਕ੍ਰਿਤੀ ਲਈ ਲੋੜੀਂਦਾ ਟੁਕੜਾ ਬਣਾਉਣ ਵਿੱਚ ਅਸਮਰੱਥ ਹੈ, ਤਾਂ ਇਹ ਅਸਫਲ ਹੋ ਜਾਂਦਾ ਹੈ। ਜੇ ਇੱਕ ਸੰਭਾਵੀ ਹੋਸਟ ਸੈੱਲ (ਜਾਂ ਹੋਸਟ ਖੁਦ, ਬਹੁ-ਸੈੱਲ ਵਾਲੇ ਜੀਵਨ ਰੂਪਾਂ ਦੇ ਮਾਮਲੇ ਵਿੱਚ) ਕੁਝ ਔਡਬਾਲ ਐਂਟੀ-ਇਨਫੈਕਸ਼ਨ ਉਪਾਵਾਂ ਨਾਲ ਬਣਾਇਆ ਗਿਆ ਹੈ (ਉਦਾਹਰਨ ਲਈ: ਛੇੜਛਾੜ-ਖੋਜ, ਆਰਐਨਏ ਤੋਂ ਪ੍ਰੋਟੀਨ ਪੈਦਾ ਕਰਨ ਤੋਂ ਪਹਿਲਾਂ ਅਖੰਡਤਾ ਦੀ ਜਾਂਚ, ਜਾਂ ਅਚਾਨਕ ਮਜ਼ਬੂਤ ​​​​ਇਮਿਊਨਿਟੀ) ), ਤਾਂ ਲਾਗ ਕਿਸੇ ਵੀ ਤਰ੍ਹਾਂ ਅਸਫਲ ਹੋ ਸਕਦੀ ਹੈ।


ਸਪਿਲਓਵਰ: ਕਿਵੇਂ ਵਾਇਰਸ ਜਾਨਵਰਾਂ ਤੋਂ ਮਨੁੱਖਾਂ ਤੱਕ ਛਾਲ ਮਾਰਦੇ ਹਨ

ਇੱਕ ਸਪਿਲਓਵਰ ਜਾਂ ਕਰਾਸ-ਸਪੀਸੀਜ਼ ਟ੍ਰਾਂਸਮਿਸ਼ਨ ਇੱਕ ਵਿਦੇਸ਼ੀ ਵਾਇਰਸ ਦੀ ਇੱਕ ਸਪੀਸੀਜ਼ ਤੋਂ ਇੱਕ ਨਵੀਂ ਮੇਜ਼ਬਾਨ ਸਪੀਸੀਜ਼ ਵਿੱਚ ਛਾਲ ਮਾਰਨ ਦੀ ਸਮਰੱਥਾ ਹੈ, ਅਤੇ ਉਸ ਨਵੀਂ ਮੇਜ਼ਬਾਨ ਸਪੀਸੀਜ਼ ਦੀ ਆਬਾਦੀ ਵਿੱਚ ਫੈਲ ਜਾਂਦੀ ਹੈ। ਨੋਟ ਕਰੋ ਕਿ ਜਰਾਸੀਮ ਕਾਰਨ ਹੋਣ ਵਾਲੀਆਂ ਬਿਮਾਰੀਆਂ ਜੋ ਜਾਨਵਰਾਂ ਅਤੇ ਮਨੁੱਖੀ ਆਬਾਦੀ ਦੋਵਾਂ ਨੂੰ ਸੰਕਰਮਿਤ ਕਰਦੀਆਂ ਹਨ ਨੂੰ ਆਮ ਤੌਰ 'ਤੇ ਜ਼ੂਨੋਸਿਸ ਕਿਹਾ ਜਾਂਦਾ ਹੈ। ਵਾਇਰਸਾਂ ਤੋਂ ਇਲਾਵਾ, ਕਈ ਬੈਕਟੀਰੀਆ, ਫੰਜਾਈ ਅਤੇ ਪਰਜੀਵੀ ਜ਼ੂਨੋਟਿਕ ਹਨ।

ਹਾਲਾਂਕਿ, ਕੁਝ ਘਟਨਾਵਾਂ ਵਿੱਚ, ਇੱਕ ਜਰਾਸੀਮ ਦੇ ਇੱਕ ਸਪੀਸੀਜ਼ ਤੋਂ ਦੂਜੀ ਸਪੀਸੀਜ਼ ਵਿੱਚ ਛਾਲ ਮਾਰਨ ਤੋਂ ਬਾਅਦ, ਇਹ ਪਰਿਵਰਤਨ ਕਰਦਾ ਹੈ ਅਤੇ ਨਵੀਂ ਮੇਜ਼ਬਾਨ ਆਬਾਦੀ ਦੇ ਅੰਦਰ ਕੁਸ਼ਲਤਾ ਅਤੇ ਵਿਸ਼ੇਸ਼ ਤੌਰ 'ਤੇ ਨਕਲ ਕਰਨ, ਫੈਲਣ ਅਤੇ ਵਿਕਸਤ ਕਰਨ ਦੇ ਸਮਰੱਥ ਇੱਕ ਨਵਾਂ ਤਣਾਅ ਬਣ ਜਾਂਦਾ ਹੈ। ਇਹ ਕਰਾਸ-ਸਪੀਸੀਜ਼ ਟ੍ਰਾਂਸਮਿਸ਼ਨ ਦੀ ਪ੍ਰਾਇਮਰੀ ਪਰਿਭਾਸ਼ਾ ਜਾਂ ਸਪਿਲਓਵਰ ਹੈ।

ਕਈ ਮਹੱਤਵਪੂਰਨ ਵਾਇਰਸ ਜਾਨਵਰਾਂ ਤੋਂ ਛਾਲ ਮਾਰ ਕੇ ਮਨੁੱਖੀ ਆਬਾਦੀ ਦੇ ਵਿਸ਼ੇਸ਼ ਰੋਗਾਣੂ ਬਣ ਗਏ ਸਨ। ਇਸ ਤੋਂ ਇਲਾਵਾ, ਉਨ੍ਹਾਂ ਵਿੱਚੋਂ ਕੁਝ ਜਨਤਕ ਸਿਹਤ ਲਈ ਵੱਡੇ ਖਤਰੇ ਬਣ ਗਏ ਹਨ, ਇਸ ਤਰ੍ਹਾਂ ਮਹਾਂਮਾਰੀ ਅਤੇ ਮਹਾਂਮਾਰੀ ਦਾ ਕਾਰਨ ਬਣਦੇ ਹਨ। ਇਹਨਾਂ ਵਿੱਚ HIV-AIDS, ਮਨੁੱਖੀ ਕੋਰੋਨਵਾਇਰਸ ਕਾਰਨ ਹੋਣ ਵਾਲੀਆਂ ਬਿਮਾਰੀਆਂ ਜਿਵੇਂ ਕਿ ਸਾਰਸ ਅਤੇ MERS, ਈਬੋਲਾ ਬੁਖਾਰ, ਏਵੀਅਨ ਫਲੂ ਜਾਂ ਬਰਡ ਫਲੂ, ਸਵਾਈਨ ਫਲੂ, ਅਤੇ COVID-2019 ਸ਼ਾਮਲ ਹਨ।


ਕ੍ਰਾਸ-ਸਪੀਸੀਜ਼ ਇਨਫੈਕਸ਼ਨ ਮਨੁੱਖੀ ਸਿਹਤ ਅਤੇ ਜੈਵ ਵਿਭਿੰਨਤਾ ਦੋਵਾਂ ਨੂੰ ਖਤਰੇ ਵਿੱਚ ਪਾਉਂਦੀ ਹੈ

ਕ੍ਰੈਡਿਟ: ਐਲੀਸਨ ਪੀਲ

ਰਾਇਲ ਸੋਸਾਇਟੀ ਅਤੇ ZSL ਦੇ ​​ਵਿਗਿਆਨੀਆਂ ਦੁਆਰਾ ਅੱਜ ਪ੍ਰਕਾਸ਼ਿਤ ਪੇਪਰਾਂ ਦੇ ਇੱਕ ਨਵੇਂ ਸੈੱਟ ਦੇ ਅਨੁਸਾਰ, ਪ੍ਰਜਾਤੀਆਂ ਵਿਚਕਾਰ ਬਿਮਾਰੀ ਦਾ ਫੈਲਣਾ ਇੱਕ "ਇੱਕ ਸਿਹਤ" ਮੁੱਦਾ ਹੈ ਜੋ ਮਨੁੱਖੀ ਸਿਹਤ ਅਤੇ ਜੰਗਲੀ ਜੀਵ ਸੁਰੱਖਿਆ ਦੋਵਾਂ ਨੂੰ ਪ੍ਰਭਾਵਿਤ ਕਰਦਾ ਹੈ।

ਦਾ ਵਿਸ਼ੇਸ਼ ਅੰਕ ਰਾਇਲ ਸੋਸਾਇਟੀ ਦੇ ਦਾਰਸ਼ਨਿਕ ਲੈਣ-ਦੇਣ ਬੀ ਸਾਰਸ, ਬਰਡ ਫਲੂ ਅਤੇ ਸਵਾਈਨ ਫਲੂ ਵਰਗੀਆਂ ਛੂਤ ਦੀਆਂ ਬਿਮਾਰੀਆਂ ਦੇ ਫੈਲਣ ਨੂੰ ਦੇਖਦਾ ਹੈ, ਇੱਕ ਪ੍ਰਜਾਤੀ ਤੋਂ ਦੂਜੀ ਤੱਕ ਅਤੇ ਕਿਵੇਂ ਇਹ ਨਾ ਸਿਰਫ਼ ਮਨੁੱਖਾਂ ਲਈ ਸਮੱਸਿਆਵਾਂ ਪੈਦਾ ਕਰ ਰਿਹਾ ਹੈ ਬਲਕਿ ਜੰਗਲੀ ਜੀਵ ਸੁਰੱਖਿਆ ਅਤੇ ਵੱਡੀ ਅਤੇ ਮਜ਼ਬੂਤ ​​ਆਬਾਦੀ ਦੇ ਬਚਾਅ ਨੂੰ ਖਤਰਾ ਪੈਦਾ ਕਰ ਰਿਹਾ ਹੈ।

ਕਾਗਜ਼ਾਂ ਵਿੱਚ ਕਿਹਾ ਗਿਆ ਹੈ ਕਿ ਜ਼ਿਆਦਾਤਰ ਖਤਰਨਾਕ ਬਿਮਾਰੀਆਂ ਸੰਕਰਮਣ ਕਾਰਨ ਹੁੰਦੀਆਂ ਹਨ ਜੋ ਸਪੀਸੀਜ਼ ਦੇ ਵਿਚਕਾਰ ਚਲਦੀਆਂ ਹਨ, ਜਿੱਥੇ ਇੱਕ ਸਪੀਸੀਜ਼ ਇੱਕ ਸਰੋਵਰ ਦਾ ਕੰਮ ਕਰਦੀ ਹੈ ਅਤੇ ਫਿਰ ਦੂਜੀ, ਵਧੇਰੇ ਕਮਜ਼ੋਰ, ਪ੍ਰਜਾਤੀਆਂ ਨੂੰ ਸੰਕਰਮਿਤ ਕਰਦੀ ਹੈ ਜੋ ਉੱਚ ਮੌਤ ਦਰ ਦਾ ਸ਼ਿਕਾਰ ਹੋ ਸਕਦੀਆਂ ਹਨ।

ZSL ਦੇ ​​ਡਾਕਟਰ ਐਂਡਰਿਊ ਕਨਿੰਘਮ ਲਿਖਦੇ ਹਨ ਕਿ ਇਸ ਮੁੱਦੇ ਨੂੰ ਇੱਕ ਸੰਪੂਰਨ, ਅੰਤਰ-ਅਨੁਸ਼ਾਸਨੀ ਹੱਲ ਦੀ ਲੋੜ ਹੈ। ਬਿਮਾਰੀ ਦੀ ਜਾਂਚ ਅਤੇ ਨਿਯੰਤਰਣ ਦੇ ਨੇੜੇ ਪਹੁੰਚਣ ਦੇ ਨਵੇਂ ਤਰੀਕਿਆਂ ਬਾਰੇ ਚਰਚਾ ਕੀਤੀ ਗਈ ਹੈ, ਜਿਵੇਂ ਕਿ ਨੀਤੀ ਨਿਰਮਾਤਾਵਾਂ ਲਈ ਸਿਫ਼ਾਰਸ਼ਾਂ ਹਨ।


HEV ਲਈ ਹੋਸਟ ਰੇਂਜ ਅਤੇ ਜਾਨਵਰਾਂ ਦੇ ਭੰਡਾਰ ਕੀ ਹਨ?

ਵੱਖ-ਵੱਖ ਜਾਨਵਰਾਂ ਦੀਆਂ ਕਿਸਮਾਂ ਤੋਂ HEV ਦੇ ਤਣਾਅ ਦੀ ਹਾਲੀਆ ਜੈਨੇਟਿਕ ਪਛਾਣ ਨੇ ਮੇਜ਼ਬਾਨ ਦੀ ਰੇਂਜ ਅਤੇ ਵਾਇਰਸ [4,7] ਦੀ ਜੈਨੇਟਿਕ ਵਿਭਿੰਨਤਾ ਨੂੰ ਮਹੱਤਵਪੂਰਨ ਤੌਰ 'ਤੇ ਵਧਾਇਆ ਹੈ। ਮਨੁੱਖਾਂ ਤੋਂ ਇਲਾਵਾ, HEV ਨੂੰ ਜੰਗਲੀ ਅਤੇ ਘਰੇਲੂ ਸਵਾਈਨ, ਹਿਰਨ, ਖਰਗੋਸ਼, ਮੂੰਗੀ, ਚਿਕਨ, ਊਠ, ਚੂਹਾ, ਫੇਰੇਟ, ਗ੍ਰੇਟਰ ਬੈਂਡੀਕੂਟ, ਏਸ਼ੀਅਨ ਮਸਕ ਸ਼ਰੂ, ਮਿੰਕ, ਮੂਜ਼, ਅਤੇ ਮੱਛੀ ਸਮੇਤ ਕਈ ਹੋਰ ਜਾਨਵਰਾਂ ਦੀਆਂ ਕਿਸਮਾਂ ਤੋਂ ਜੈਨੇਟਿਕ ਤੌਰ 'ਤੇ ਪਛਾਣਿਆ ਗਿਆ ਹੈ। 1) [8,9]। HEV ਦੀਆਂ ਚੰਗੀ ਤਰ੍ਹਾਂ ਵਿਸ਼ੇਸ਼ਤਾ ਵਾਲੀਆਂ ਜਾਨਵਰਾਂ ਦੀਆਂ ਕਿਸਮਾਂ ਵਿੱਚ ਘਰੇਲੂ ਅਤੇ ਜੰਗਲੀ ਸੂਰਾਂ ਤੋਂ ਜੀਨੋਟਾਈਪ 3 ਅਤੇ 4 ਸਵਾਈਨ HEV, ਜੀਨੋਟਾਈਪ 3 ਖਰਗੋਸ਼ HEV, ਅਤੇ ਮੁਰਗੀਆਂ ਤੋਂ ਏਵੀਅਨ HEV ਸ਼ਾਮਲ ਹਨ। ਮਨੁੱਖੀ ਅਤੇ ਸਵਾਈਨ ਤੋਂ ਇਲਾਵਾ, ਖਰਗੋਸ਼, ਹਿਰਨ ਅਤੇ ਮੂੰਗੀ ਤੋਂ ਵੀ ਜੀਨੋਟਾਈਪ 3 HEV ਕਿਸਮਾਂ ਦੀ ਪਛਾਣ ਕੀਤੀ ਗਈ ਹੈ। ਚੂਹਿਆਂ ਅਤੇ ਫੈਰੇਟਸ ਹਰੇਕ ਵਿੱਚ HEV-ਸਬੰਧਤ ਤਣਾਅ ਹੁੰਦੇ ਹਨ ਜੋ ਜੈਨੇਟਿਕ ਤੌਰ 'ਤੇ ਦੂਜੇ ਥਣਧਾਰੀ ਅਤੇ ਏਵੀਅਨ HEV (ਟੇਬਲ 1) ਤੋਂ ਵੱਖਰੇ ਹੁੰਦੇ ਹਨ। ਸਪੀਸੀਜ਼ ਦੇ ਅੰਦਰ ਮੂਜ਼ HEV ਕਲੱਸਟਰ ਹਨ ਆਰਥੋਹੇਪੀਵਾਇਰਸ ਏ ਜੀਨੋਟਾਈਪ 1𠄶 ਵਾਇਰਸ [9,10] ਦੇ ਸਾਂਝੇ ਪੂਰਵਜ ਦੇ ਨਾਲ ਇੱਕ ਵੱਖਰਾ ਕਲੇਡ ਬਣਾਉਂਦੇ ਹਨ। ਕਟਥਰੋਟ ਟ੍ਰਾਊਟ ਵਾਇਰਸ ਘੱਟ ਨਿਊਕਲੀਓਟਾਈਡ ਕ੍ਰਮ ਪਛਾਣ [11] ਦੇ ਬਾਵਜੂਦ ਇਸਦੇ ਜੀਨੋਮਿਕ ਸੰਗਠਨ (ਚਿੱਤਰ 1) ਵਿੱਚ ਥਣਧਾਰੀ ਹੈਪੀਵਾਇਰਸ ਨਾਲ ਮਿਲਦਾ ਜੁਲਦਾ ਹੈ ਅਤੇ ਇੱਕ ਵੱਖਰੀ ਜੀਨਸ ਨੂੰ ਦਰਸਾਉਂਦਾ ਹੈ। ਪਿਸੀਹੇਪੀਵਾਇਰਸ. HEV ਦੇ ਇਹਨਾਂ ਵਿਭਿੰਨ ਜਾਨਵਰਾਂ ਦੇ ਤਣਾਅ ਦੀ ਜੈਨੇਟਿਕ ਪਛਾਣ ਨੇ HEV ਲਈ ਨਾਵਲ, ਕੁਦਰਤੀ ਤੌਰ 'ਤੇ ਜਾਨਵਰਾਂ ਦੇ ਮਾਡਲਾਂ ਨੂੰ ਵਿਕਸਤ ਕਰਨ ਦੇ ਮੌਕੇ ਪ੍ਰਦਾਨ ਕੀਤੇ।

ਇਸ ਤੋਂ ਇਲਾਵਾ, ਕਈ ਹੋਰ ਜਾਨਵਰਾਂ ਦੀਆਂ ਕਿਸਮਾਂ ਵਿੱਚ HEV ਦੀ ਲਾਗ ਦੇ ਸੀਰੋਲੋਜੀਕਲ ਸਬੂਤ ਵੀ ਰਿਪੋਰਟ ਕੀਤੇ ਗਏ ਹਨ, ਹਾਲਾਂਕਿ ਇਹਨਾਂ ਸਪੀਸੀਜ਼ ਵਿੱਚ ਸੀਰੋਪੋਜ਼ਿਟਿਵਿਟੀ ਦੇ ਸਰੋਤ ਦੀ ਅਜੇ ਤੱਕ ਜੈਨੇਟਿਕ ਤੌਰ 'ਤੇ ਪਛਾਣ ਨਹੀਂ ਕੀਤੀ ਗਈ ਹੈ। ਐਂਟੀ-ਐੱਚ.ਈ.ਵੀ. ਐਂਟੀਬਾਡੀਜ਼ ਕਥਿਤ ਤੌਰ 'ਤੇ ਬੱਕਰੀਆਂ, ਪਸ਼ੂਆਂ, ਅਤੇ ਭੇਡਾਂ ਵਰਗੀਆਂ ਕਈ ਕਿਸਮਾਂ ਵਿੱਚ ਖੋਜੀਆਂ ਜਾਂਦੀਆਂ ਹਨ, ਨਾਲ ਹੀ ਕੁੱਤਿਆਂ ਅਤੇ ਬਿੱਲੀਆਂ ਵਿੱਚ ਵੀ HEV-ਸਬੰਧਤ ਕ੍ਰਮਾਂ ਦੀ ਕੋਈ ਖੋਜ ਨਹੀਂ ਹੁੰਦੀ ਹੈ। ਇਹਨਾਂ ਜਾਨਵਰਾਂ ਦੀਆਂ ਕਿਸਮਾਂ ਵਿੱਚ HEV ਸੇਰੋਪੋਜ਼ਿਟਿਵਿਟੀ ਲਈ ਸਰੋਤਾਂ ਦੀ ਨਿਸ਼ਚਿਤ ਜੈਨੇਟਿਕ ਪਛਾਣ HEV ਦੇ ਨਵੇਂ ਜਾਨਵਰਾਂ ਦੇ ਤਣਾਅ ਦੀ ਖੋਜ ਵੱਲ ਅਗਵਾਈ ਕਰੇਗੀ ਅਤੇ ਇਸ ਤਰ੍ਹਾਂ HEV ਹੋਸਟ ਰੇਂਜ ਦਾ ਹੋਰ ਵਿਸਥਾਰ ਕਰੇਗੀ।


ਸਮੱਗਰੀ ਅਤੇ ਢੰਗ

ਨੈਤਿਕਤਾ ਬਿਆਨ

ਖੂਨ ਦੇ ਨਮੂਨੇ ਮਨੁੱਖੀ ਵਿਸ਼ਿਆਂ ਤੋਂ ਲਏ ਗਏ ਸਨ, ਜਿਨ੍ਹਾਂ ਦੀ ਉਮਰ 18-70 ਸਾਲ ਦੀ ਉਮਰ ਦੇ ਸਾਰੇ ਵਿਸ਼ਿਆਂ ਤੋਂ ਲਿਖਤੀ-ਸੂਚਿਤ ਸਹਿਮਤੀ ਪ੍ਰਾਪਤ ਕੀਤੀ ਗਈ ਸੀ। ਮਨੁੱਖੀ ਨਮੂਨਿਆਂ ਨੂੰ ਸ਼ਾਮਲ ਕਰਨ ਵਾਲੇ ਸਾਰੇ ਪ੍ਰਯੋਗਾਤਮਕ ਪ੍ਰੋਟੋਕੋਲ ਕਾਂਗਵੋਨ ਨੈਸ਼ਨਲ ਯੂਨੀਵਰਸਿਟੀ ਹਸਪਤਾਲ ਨੈਤਿਕ ਕਮੇਟੀ (IRB ਨੰਬਰ 2014-08-008-002), ਮਲਾਇਆ ਯੂਨੀਵਰਸਿਟੀ ਮੈਡੀਕਲ ਐਥਿਕਸ ਕਮੇਟੀ (ਰੈਫ ਨੰਬਰ 817.18), ਅਤੇ ਮੈਡੀਕਲ ਰਿਸਰਚ ਐਥਿਕਸ ਕਮੇਟੀ (ਆਈਆਰਬੀ ਨੰਬਰ 2014-08-008-002) ਦੁਆਰਾ ਮਨਜ਼ੂਰ ਕੀਤੇ ਗਏ ਸਨ। MREC), ਸਿਹਤ ਮੰਤਰਾਲਾ, ਮਲੇਸ਼ੀਆ (ਰਾਸ਼ਟਰੀ ਮੈਡੀਕਲ ਖੋਜ ਰਜਿਸਟਰ ID ਨੰ. ​​13079), ਸੰਬੰਧਿਤ ਦਿਸ਼ਾ-ਨਿਰਦੇਸ਼ਾਂ ਅਤੇ ਨਿਯਮਾਂ ਦੇ ਅਨੁਸਾਰ। ਤੋਂ ਖੂਨ ਦੇ ਨਮੂਨੇ ਲਏ ਗਏ ਪੀ. knowlesi2010-2013 ਦੌਰਾਨ ਮਲੇਸ਼ੀਆ ਯੂਨੀਵਰਸਿਟੀ ਆਫ ਮਲਾਇਆ ਮੈਡੀਕਲ ਸੈਂਟਰ (UMMC) ਦੁਆਰਾ ਪ੍ਰਦਾਨ ਕੀਤੇ ਗਏ EDTA-ਵੈਕਟੇਨਰ ਟਿਊਬਾਂ ਵਿੱਚ ਸੰਕਰਮਿਤ ਮਰੀਜ਼, ਜਿਸ ਦਿਨ ਮਰੀਜ਼ਾਂ ਨੂੰ ਮਲੇਰੀਆ ਦਾ ਸਕਾਰਾਤਮਕ ਨਿਦਾਨ ਕੀਤਾ ਗਿਆ ਸੀ। ਸਾਰੇ ਪੀ. knowlesi ਇਸ ਅਧਿਐਨ ਲਈ ਵਰਤੇ ਗਏ ਨਮੂਨਿਆਂ ਦੀ ਪੁਸ਼ਟੀ ਸਪੀਸੀਜ਼-ਵਿਸ਼ੇਸ਼ ਪੀਸੀਆਰ ਦੁਆਰਾ ਕੀਤੀ ਗਈ ਸੀ ਜਿਵੇਂ ਕਿ ਕਿਤੇ ਹੋਰ ਦੱਸਿਆ ਗਿਆ ਹੈ [4]। ਮਰੀਜ਼ਾਂ ਦਾ ਸੀਰਮ 0.207% ਔਸਤਨ (0.003 ਤੋਂ 1.380% ਤੱਕ) ਅਤੇ ਔਸਤਨ 38 ਸਾਲ ਦੀ ਉਮਰ (6 ਤੋਂ 72 ਤੱਕ) ਦੇ ਨਾਲ ਮਲੇਸ਼ੀਆ ਦੇ ਸਥਾਨਕ ਖੇਤਰਾਂ ਵਿੱਚ ਜਾਣ ਵਾਲੇ ਲੱਛਣ ਵਾਲੇ ਮਰੀਜ਼ਾਂ ਤੋਂ ਇਕੱਤਰ ਕੀਤਾ ਗਿਆ ਸੀ। ਹਾਲਾਂਕਿ, ਅਸੀਂ ਮਰੀਜ਼ਾਂ ਤੋਂ ਪਿਛਲੇ ਮਲੇਰੀਆ ਦੀ ਲਾਗ ਦੇ ਇਤਿਹਾਸ ਬਾਰੇ ਜਾਣਕਾਰੀ ਪ੍ਰਾਪਤ ਨਹੀਂ ਕੀਤੀ। ਪੀ. vivax- ਸੰਕਰਮਿਤ ਮਰੀਜ਼ਾਂ ਨੂੰ ਏ ਤੋਂ ਭਰਤੀ ਕੀਤਾ ਗਿਆ ਸੀ ਪੀ. vivax- ਗੈਂਗਵੋਨ ਪ੍ਰਾਂਤ, ਕੋਰੀਆ ਗਣਰਾਜ (ROK) ਵਿੱਚ ਸਧਾਰਣ ਖੇਤਰ ਜਿੱਥੇ ਪੀ. vivax ਪ੍ਰਮੁੱਖ ਹੈ ਪਲਾਜ਼ਮੋਡੀਅਮ ਸਪੀਸੀਜ਼, ਕੋਈ ਨਹੀਂ ਹੈ ਪੀ. knowlesi ਇਸ ਖੇਤਰ ਵਿੱਚ ਲਾਗ [1]. ਦੇ ਨਾਲ ਮਰੀਜ਼ ਪੀ. ਫਾਲਸੀਪੇਰਮ ਇਸ ਅਧਿਐਨ ਵਿੱਚ ਲਾਗ ਨੂੰ ਬਾਹਰ ਰੱਖਿਆ ਗਿਆ ਸੀ। ਸੀਰਾ 0.027 ਤੋਂ 0.630%, ਮਤਲਬ 0.121%) ਅਤੇ ਉਮਰ 18 ਤੋਂ 60 ਸਾਲ (ਮਤਲਬ 28) ਦੇ ਪੈਰਾਸਾਈਟਮੀਆ ਵਾਲੇ ਗੈਂਗਵੋਨ ਪ੍ਰਾਂਤ, ROK ਵਿੱਚ ਸਥਾਨਕ ਸਿਹਤ ਕੇਂਦਰਾਂ ਅਤੇ ਕਲੀਨਿਕਾਂ ਵਿੱਚ ਆਉਣ ਵਾਲੇ ਲੱਛਣ ਵਾਲੇ ਮਰੀਜ਼ਾਂ ਤੋਂ ਇਕੱਠੀ ਕੀਤੀ ਗਈ ਸੀ। ਪੀ. vivax ਅਤੇ ਪੀ. knowlesi ਅੱਠ ਮਰੀਜ਼ਾਂ ਦੇ ਸੀਰਮ ਦੇ ਨਮੂਨੇ ਸਪੀਸੀਜ਼-ਵਿਸ਼ੇਸ਼ ਪੀਸੀਆਰ ਅਤੇ ਅੱਠ ਸਿਹਤ ਵਿਅਕਤੀਆਂ ਤੋਂ ਬਿਨਾਂ ਲਏ ਗਏ ਸਨ ਪਲਾਜ਼ਮੋਡੀਅਮ ਲਾਗ. ਕੁੱਲ 70 ਵਿਅਕਤੀ ਪੀ. vivax-, ਪੀ. knowlesi- ਸੰਕਰਮਿਤ ਮਰੀਜ਼ਾਂ ਦੇ ਸੀਰਮ ਅਤੇ ਸਿਹਤ ਵਿਅਕਤੀਆਂ ਦੀ ਵਰਤੋਂ ਸ਼ੁਰੂਆਤੀ ਪੂਲਡ-ਸੀਰਮ ਸਕ੍ਰੀਨਿੰਗ ਤੋਂ ਬਾਅਦ ਵਿਅਕਤੀਗਤ ਇਮਯੂਨੋਸਕ੍ਰੀਨਿੰਗ ਲਈ ਕੀਤੀ ਗਈ ਸੀ। ROK ਮਲੇਰੀਆ ਦੀ ਨਕਾਰਾਤਮਕਤਾ ਦੀ ਪੁਸ਼ਟੀ ਮਾਈਕ੍ਰੋਸਕੋਪੀ ਅਤੇ ਪੀਸੀਆਰ ਦੁਆਰਾ ਕੀਤੀ ਗਈ ਸੀ।

ਅਮੀਨੋ ਐਸਿਡ ਪਛਾਣ ਦਾ ਕ੍ਰਮ ਵਿਸ਼ਲੇਸ਼ਣ

ਟਾਰਗੇਟ ਐਂਟੀਜੇਨਜ਼ ਸਾਡੇ ਪਿਛਲੇ ਅਧਿਐਨਾਂ ਤੋਂ ਚੁਣੇ ਗਏ ਸਨ ਜੋ ਕਿ ਵੱਖ-ਵੱਖ apical organelles/ merozoite ਸਤਹ ਵਿੱਚ ਸਥਾਨਿਕ ਸਨ। ਪੀ. vivax ਅਤੇ ਮਨੁੱਖੀ ਮਰੀਜ਼ਾਂ ਦੇ ਸੀਰਮ ਦੁਆਰਾ ਪਛਾਣੇ ਗਏ ਸਨ (ਸਾਰਣੀ 1, ਹਵਾਲੇ ਵੇਖੋ)। ਦੇ ਅਮੀਨੋ ਐਸਿਡ ਕ੍ਰਮ ਪੀ. vivax (ਸਾਲ I ਅਤੇ P01 ਤਣਾਅ) ਅਤੇ ਪੀ. knowlesi (H ਸਟ੍ਰੇਨ) ਨੂੰ PlasmoDB (www.plasmodb.org) [32] ਤੋਂ ਪ੍ਰਾਪਤ ਕੀਤਾ ਗਿਆ ਸੀ ਅਤੇ ਇਕਸਾਰ ਕੀਤਾ ਗਿਆ ਸੀ। ਕਲਸਟਲ ਡਬਲਯੂ ਪ੍ਰੋਗਰਾਮ ਦੀ ਵਰਤੋਂ ਪ੍ਰਤੀਸ਼ਤ ਅਮੀਨੋ ਐਸਿਡ ਪਛਾਣ (ਟੇਬਲ 1 ਅਤੇ S1 ਚਿੱਤਰ) ਨੂੰ ਨਿਰਧਾਰਤ ਕਰਨ ਲਈ ਇੱਕ ਜੋੜਾ ਅਨੁਕੂਲਤਾ ਬਣਾਉਣ ਲਈ ਕੀਤੀ ਗਈ ਸੀ।

ਖੂਨ-ਪੜਾਅ ਦੇ ਵਿਟਰੋ ਸੱਭਿਆਚਾਰ ਵਿੱਚ ਪੀ. knowlesi ਪਰਜੀਵੀ

ਮਨੁੱਖਾ-ਅਨੁਕੂਲ ਪੀ. knowlesi A1-H.1 ਸਟ੍ਰੇਨ ਨੂੰ RPMI 1640-ਅਧਾਰਿਤ ਮਾਧਿਅਮ (ਇਨਵਿਟ੍ਰੋਜਨ/ਲਾਈਫ ਟੈਕਨਾਲੋਜੀਜ਼, ਗ੍ਰੈਂਡ ਆਈਲੈਂਡ, NY) ਵਿੱਚ ਤਾਜ਼ਾ ਮਨੁੱਖੀ ਏਰੀਥਰੋਸਾਈਟਸ ਨਾਲ ਬਣਾਈ ਰੱਖਿਆ ਗਿਆ ਸੀ ਜਿਵੇਂ ਕਿ ਪਹਿਲਾਂ ਦੱਸਿਆ ਗਿਆ ਹੈ [53]।

ਰੀਕੌਂਬੀਨੈਂਟ ਪ੍ਰੋਟੀਨ ਸਮੀਕਰਨ

ਪੀ. vivax ਰੀਕੌਂਬੀਨੈਂਟ ਪ੍ਰੋਟੀਨ ਕਣਕ ਦੇ ਜਰਮ ਸੈੱਲ-ਮੁਕਤ ਜਾਂ ਦੁਆਰਾ ਤਿਆਰ ਕੀਤੇ ਗਏ ਸਨ . ਕੋਲੀ ਸਾਡੇ ਪਿਛਲੇ ਅਧਿਐਨਾਂ ਵਿੱਚ ਸਮੀਕਰਨ ਪ੍ਰਣਾਲੀਆਂ [25,42,44,50]। ਡੀਐਨਏ ਟੁਕੜੇ ਇੰਕੋਡਿੰਗ PvRBP1a-34, Pv41, ਜ PvRhopH2 ਇੱਕ ਕੋਰੀਆਈ vivax ਥਲੱਗ ਤੱਕ ਦੇ ਨਾਲ primers PvRBP1a-34_F ਉਜਾਗਰ ਕੀਤਾ ਗਿਆ ਸੀ (ggtcgcggatcc gaattc ATGAACGAACTAGGTATAGACATT) ਅਤੇ PvRBP1a-34_R (ggtggtggtg ctcgag TTCAAACTCTATCTTCAGTTC) Pv41_F (ggtcgcggatcc gaattc ATGGAACACATCTGCGATTTTAC) ਅਤੇ Pv41_R (ggtggtggtg ctcgag CTCCTGGAAGGACTTGGCA) ਅਤੇ PvRhopH2_F (ggtcgcggatcc gaattc ATGGAGCTGAGCCACAGC) ਅਤੇ PvRhopH2_R (ggtggtggtg ctcgag CTTCTCCACATCCTCGTGGT), ਕ੍ਰਮਵਾਰ। ਛੋਟੇ ਅੱਖਰ ਪਲਾਜ਼ਮੀਡ ਤੋਂ ਪ੍ਰਾਪਤ ਕ੍ਰਮ ਨੂੰ ਦਰਸਾਉਂਦੇ ਹਨ ਅਤੇ ਰੇਖਾਂਕਿਤ ਅੱਖਰ ਕ੍ਰਮਵਾਰ ਐਂਜ਼ਾਈਮ ਪਾਬੰਦੀ ਸਾਈਟਾਂ, EcoRI ਅਤੇ XhoI ਨੂੰ ਦਰਸਾਉਂਦੇ ਹਨ। ਹਾਈ ਫਿਡੇਲਿਟੀ KOD-ਪਲੱਸ ਕਿੱਟ (ਟੋਯੋਬੋ ਕੰਪਨੀ, ਓਸਾਕਾ, ਜਾਪਾਨ) ਨੂੰ 2 ਮਿੰਟ ਲਈ 94°C 'ਤੇ ਸ਼ੁਰੂਆਤੀ ਵਿਨਾਸ਼ਕਾਰੀ ਪੜਾਅ ਦੇ ਨਾਲ ਵਰਤਿਆ ਗਿਆ ਸੀ, ਇਸ ਤੋਂ ਬਾਅਦ 15 ਸਕਿੰਟ ਲਈ 94°C ਦੇ 35 ਚੱਕਰ, 30 ਸਕਿੰਟ ਲਈ 60°C, ਅਤੇ 1.5 ਮਿੰਟ ਲਈ 58°C ਅਤੇ 10 ਮਿੰਟ ਲਈ 68°C 'ਤੇ ਅੰਤਮ ਐਕਸਟੈਂਸ਼ਨ ਪੜਾਅ। ਐਂਪਲੀਕਨਾਂ ਨੂੰ ਜੈੱਲ ਐਕਸਟਰੈਕਸ਼ਨ ਕਿੱਟ ਦੀ ਵਰਤੋਂ ਕਰਕੇ ਸ਼ੁੱਧ ਕੀਤਾ ਗਿਆ ਸੀ ਅਤੇ PvRBP1a-34 ਲਈ pET28a(+) ਸਮੀਕਰਨ ਵੈਕਟਰ (Novagen, Madison, WI) ਵਿੱਚ ਜਾਂ Pv41 ਅਤੇ PvRhopH2 ਲਈ ਇੱਕ ਹਿਸ-ਟੈਗ ਦੇ ਨਾਲ pET23a(+) ਸਮੀਕਰਨ ਵੈਕਟਰ ਵਿੱਚ ਜੋੜਿਆ ਗਿਆ ਸੀ। ਸਹੀ ਢੰਗ ਨਾਲ ਲਿਗੇਟਿਡ ਪਲਾਜ਼ਮੀਡਾਂ ਵਿੱਚ ਬਦਲਿਆ ਗਿਆ ਸੀ . ਕੋਲੀ BL21(DE3) pLysS (ਲਾਈਫ ਟੈਕਨਾਲੋਜੀ) ਰੀਕੌਂਬੀਨੈਂਟ ਪ੍ਰੋਟੀਨ ਸਮੀਕਰਨ ਲਈ। ਰੀਕੌਂਬੀਨੈਂਟ ਪ੍ਰੋਟੀਨ ਸਮੀਕਰਨ ਨੂੰ 0.1 ਐਮਐਮ ਆਈਸੋਪ੍ਰੋਪਾਈਲ-ਬੀਟਾ-ਡੀ-ਥਿਓਗਲੈਕਟੋਪੀਰਾਨੋਸਾਈਡ (IPTG ਸਿਗਮਾ-ਐਲਡਰਿਕ, ਸੇਂਟ ਲੂਇਸ, MO) ਨਾਲ ਪ੍ਰੇਰਿਤ ਕੀਤਾ ਗਿਆ ਸੀ। ਸਾਰੇ ਰੀਕੌਂਬੀਨੈਂਟ ਪ੍ਰੋਟੀਨ ਘੁਲਣਸ਼ੀਲ, ਸ਼ੁੱਧ ਕੀਤੇ ਗਏ ਸਨ, ਅਤੇ ਹੋਰ ਕਿਤੇ ਵਰਣਨ ਕੀਤੇ ਅਨੁਸਾਰ ਮੁੜ ਫੋਲਡ ਕੀਤੇ ਗਏ ਸਨ [47,54]।

ਇਸ ਦੌਰਾਨ ਸ. ਪੀ. knowlesi ਵਿਸ਼ੇਸ਼ ਪ੍ਰਾਈਮਰਾਂ (S2 ਟੇਬਲ) ਦੀ ਵਰਤੋਂ ਕਰਦੇ ਹੋਏ ਇਮਯੂਨੋਸਕ੍ਰੀਨਿੰਗ ਲਈ ਕਣਕ ਦੇ ਕੀਟਾਣੂ ਸੈੱਲ-ਮੁਕਤ ਪ੍ਰਣਾਲੀ ਦੀ ਵਰਤੋਂ ਕਰਦੇ ਹੋਏ ਇਸ ਅਧਿਐਨ ਲਈ ਰੀਕੌਂਬੀਨੈਂਟ ਪ੍ਰੋਟੀਨ ਪ੍ਰਗਟ ਕੀਤੇ ਗਏ ਸਨ, ਪ੍ਰਕਿਰਿਆਵਾਂ ਦਾ ਕਿਤੇ ਹੋਰ ਵਰਣਨ ਕੀਤਾ ਗਿਆ ਸੀ[47]। Recombinant PkDBPα ਪ੍ਰੋਟੀਨ ਸਮੀਕਰਨ ਹੋਰ ਕਿਤੇ ਵਰਣਨ ਕੀਤਾ ਗਿਆ ਸੀ [47]. DNA ਟੁਕੜਾ ਏਨਕੋਡਿੰਗ PkRhopH2 ਤੋਂ ਵਧਾਇਆ ਗਿਆ ਸੀ ਪੀ. knowlesi ਪ੍ਰਾਈਮਰ ਪੇਅਰ PkRhopH2_F (ggtcgcggatcc gaattc ATGGAGTTAGGCCATACCGTG) ਅਤੇ PkRhopH2_R (ggtggtggtg ctcgag CTTCTCGATGTCTTCGTAGTCCA) ਦੇ ਨਾਲ A1-H.1 ਜੀਨੋਮਿਕ DNA। ਲੋਅਰਕੇਸ ਅੱਖਰ ਪਲਾਜ਼ਮੀਡ ਤੋਂ ਪ੍ਰਾਪਤ ਕ੍ਰਮ ਦਰਸਾਉਂਦੇ ਹਨ ਅਤੇ ਰੇਖਾਂਕਿਤ ਅੱਖਰ ਕ੍ਰਮਵਾਰ EcoRI ਅਤੇ XhoI ਲਈ ਐਨਜ਼ਾਈਮ ਪਾਬੰਦੀ ਸਾਈਟਾਂ ਨੂੰ ਦਰਸਾਉਂਦੇ ਹਨ। ਇੱਕ ਉੱਚ ਵਫ਼ਾਦਾਰੀ KOD-ਪਲੱਸ ਕਿੱਟ ਦੀ ਵਰਤੋਂ 2 ਮਿੰਟ ਲਈ 94°C 'ਤੇ ਸ਼ੁਰੂਆਤੀ ਵਿਨਾਸ਼ਕਾਰੀ ਪੜਾਅ ਦੇ ਨਾਲ ਕੀਤੀ ਗਈ ਸੀ, ਇਸ ਤੋਂ ਬਾਅਦ 15 ਸਕਿੰਟ ਲਈ 94°C ਦੇ 35 ਚੱਕਰ, 30 ਸੈਕਿੰਡ ਲਈ 60°C, ਅਤੇ 1.5 ਮਿੰਟ ਲਈ 58°C ਅਤੇ ਇੱਕ 10 ਮਿੰਟ ਲਈ 68°C 'ਤੇ ਅੰਤਮ ਐਕਸਟੈਂਸ਼ਨ ਪੜਾਅ। ਐਂਪਲੀਕਨਾਂ ਨੂੰ ਜੈੱਲ ਐਕਸਟਰੈਕਸ਼ਨ ਕਿੱਟ ਦੀ ਵਰਤੋਂ ਕਰਕੇ ਸ਼ੁੱਧ ਕੀਤਾ ਗਿਆ ਸੀ ਅਤੇ ਹਿਸ-ਟੈਗ ਦੇ ਨਾਲ pET28a(+) ਸਮੀਕਰਨ ਵੈਕਟਰ ਵਿੱਚ ਲੀਗ ਕੀਤਾ ਗਿਆ ਸੀ। ਸਹੀ ਢੰਗ ਨਾਲ ਲਿਗੇਟਿਡ ਪਲਾਜ਼ਮੀਡਾਂ ਵਿੱਚ ਬਦਲਿਆ ਗਿਆ ਸੀ . ਕੋਲੀ BL21(DE3)। ਪ੍ਰੋਟੀਨ ਸਮੀਕਰਨ ਅਤੇ ਸ਼ੁੱਧੀਕਰਨ ਉੱਪਰ ਦੱਸੇ ਅਨੁਸਾਰ ਕੀਤਾ ਗਿਆ ਸੀ. ਪੀ. knowlesi MSP1-19 ਪ੍ਰੋਟੀਨ ਨੂੰ ਨਿਰਮਾਤਾ ਦੇ ਮੈਨੂਅਲ ਦੇ ਅਨੁਸਾਰ ਇਨ-ਫਿਊਜ਼ਨ ਕਲੋਨਿੰਗ ਦੁਆਰਾ pGEX-4T-2 ਵੈਕਟਰ (GE ਹੈਲਥਕੇਅਰ ਲਾਈਫ ਸਾਇੰਸਜ਼, ਉਪਸਾਲਾ, ਸਵੀਡਨ) ਵਿੱਚ ਕਲੋਨ ਕੀਤਾ ਗਿਆ ਸੀ, ਅਤੇ ਕਲੋਨ ਕੀਤੇ pDNAs ਨੂੰ ਮੁੜ ਸੰਜੋਗ ਪ੍ਰੋਟੀਨ ਸਮੀਕਰਨ ਲਈ BL21 (DE3) ਸਮਰੱਥ ਸੈੱਲਾਂ ਵਿੱਚ ਬਦਲ ਦਿੱਤਾ ਗਿਆ ਸੀ। . ਪ੍ਰੋਟੀਨ ਨੂੰ Glutathione Sepharose 4B (GE Healthcare Life Sciences) ਨਾਲ ਸ਼ੁੱਧ ਕੀਤਾ ਗਿਆ ਸੀ ਅਤੇ ਚੂਹਿਆਂ ਦੇ ਐਂਟੀਬਾਡੀ ਉਤਪਾਦਨ ਲਈ ਵਰਤਿਆ ਗਿਆ ਸੀ।

SDS-PAGE ਅਤੇ ਪੱਛਮੀ ਬਲੌਟ ਵਿਸ਼ਲੇਸ਼ਣ

ਤੋਂ ਪੈਰਾਸਾਈਟ ਲਾਈਸੈਟਸ ਤਿਆਰ ਕੀਤੇ ਗਏ ਸਨ ਪੀ. knowlesi schizon ਜਿਵੇਂ ਕਿ ਪਹਿਲਾਂ ਦੱਸਿਆ ਗਿਆ ਹੈ [55]. ਰੀਕੌਂਬੀਨੈਂਟ ਪ੍ਰੋਟੀਨ ਨੂੰ 13% SDS-PAGE ਦੁਆਰਾ ਘਟਾਉਣ ਜਾਂ ਗੈਰ-ਘਟਾਉਣ ਵਾਲੀਆਂ ਸਥਿਤੀਆਂ ਦੇ ਤਹਿਤ ਵੱਖ ਕੀਤਾ ਗਿਆ ਸੀ ਅਤੇ 0.25% Coomassie ਸ਼ਾਨਦਾਰ ਨੀਲੇ R-250 (ਸਿਗਮਾ-ਐਲਡਰਚ) ਨਾਲ ਦਾਗਿਆ ਗਿਆ ਸੀ ਅਤੇ ਪੱਛਮੀ-ਬਲੌਟਿੰਗ ਵਿਸ਼ਲੇਸ਼ਣ [25] ਲਈ ਵਰਤਿਆ ਗਿਆ ਸੀ। ਝਿੱਲੀ-ਤਬਾਦਲਾ ਪ੍ਰੋਟੀਨ ਨੂੰ ਪ੍ਰਾਇਮਰੀ ਖਰਗੋਸ਼ ਪੌਲੀਕਲੋਨਲ ਸੀਰਮ (1:50) ਜਾਂ ਇੱਕ ਐਂਟੀ-ਹਿਜ਼ ਮੋਨੋਕਲੋਨਲ ਐਂਟੀਬਾਡੀ (1:2,000, ਹਿਲਡੇਨ, ਹੈਮਬਰਗ, ਜਰਮਨੀ) ਨਾਲ ਪ੍ਰਤੀਕ੍ਰਿਆ ਕੀਤੀ ਗਈ ਅਤੇ ਫਿਰ ਸੈਕੰਡਰੀ ਆਈਆਰਡੀਏ-ਲੇਬਲ ਵਾਲੇ ਬੱਕਰੀ ਵਿਰੋਧੀ ਖਰਗੋਸ਼ ਜਾਂ ਬੱਕਰੀ ਵਿਰੋਧੀ ਨਾਲ ਪ੍ਰਤੀਕ੍ਰਿਆ ਕੀਤੀ ਗਈ। -ਮਾਊਸ ਐਂਟੀਬਾਡੀਜ਼ (1:10,000) (LI-COR ਬਾਇਓਸਾਇੰਸ, ਲਿੰਕਨ, NE)। ਬੈਂਡਾਂ ਦੀ ਕਲਪਨਾ ਕਰਨ ਲਈ ਇੱਕ ਓਡੀਸੀ ਇਨਫਰਾਰੈੱਡ ਇਮੇਜਿੰਗ ਸਿਸਟਮ (LI-COR ਬਾਇਓਸਾਇੰਸ) ਅਤੇ ਓਡੀਸੀ ਸੌਫਟਵੇਅਰ (LI-COR ਬਾਇਓਸਾਇੰਸ) ਦੀ ਵਰਤੋਂ ਕੀਤੀ ਗਈ ਸੀ।

ਜਾਨਵਰ ਐਂਟੀਬਾਡੀ ਉਤਪਾਦਨ ਅਤੇ ਆਈਜੀਜੀ ਸ਼ੁੱਧੀਕਰਨ

ਸਾਰੇ ਪੀ. vivax ਸਾਡੇ ਪਿਛਲੇ ਅਧਿਐਨਾਂ (ਸਾਰਣੀ 1, S3 ਸਾਰਣੀ) ਦੌਰਾਨ ਖੂਨ-ਪੜਾਅ ਦੇ ਐਂਟੀਜੇਨ-ਵਿਸ਼ੇਸ਼ ਐਂਟੀਬਾਡੀਜ਼ ਪ੍ਰਾਪਤ ਕੀਤੇ ਗਏ ਸਨ। ਨਿਰਮਾਤਾ ਦੇ ਪ੍ਰੋਟੋਕੋਲ (GE ਹੈਲਥਕੇਅਰ ਲਾਈਫ ਸਾਇੰਸਜ਼) ਦੇ ਅਨੁਸਾਰ ਪ੍ਰੋਟੀਨ G HP ਕਾਲਮ ਦੀ ਵਰਤੋਂ ਕਰਕੇ ਕੁੱਲ IgG ਨੂੰ 1 ਮਿ.ਲੀ. ਖਰਗੋਸ਼ ਸੀਰਮ ਤੋਂ ਸ਼ੁੱਧ ਕੀਤਾ ਗਿਆ ਸੀ [47]। ਸਾਰੇ ਜਾਨਵਰਾਂ ਦੇ ਪ੍ਰਯੋਗਾਤਮਕ ਪ੍ਰੋਟੋਕੋਲ ਨੂੰ ਸੰਸਥਾਗਤ ਨੈਤਿਕਤਾ ਕਮੇਟੀ ਦੁਆਰਾ ਮਨਜ਼ੂਰੀ ਦਿੱਤੀ ਗਈ ਸੀ ਅਤੇ ਕੰਗਵੋਨ ਨੈਸ਼ਨਲ ਯੂਨੀਵਰਸਿਟੀ (KIACUC-16-0158) ਦੇ ਪਸ਼ੂ ਪ੍ਰਯੋਗਾਂ ਲਈ ਨੈਤਿਕ ਦਿਸ਼ਾ-ਨਿਰਦੇਸ਼ਾਂ ਦੀ ਪਾਲਣਾ ਕੀਤੀ ਗਈ ਸੀ।

ਰੋਗੀ ਸੀਰਮ ਦੇ ਨਮੂਨਿਆਂ ਤੋਂ ਐਂਟੀਜੇਨ-ਵਿਸ਼ੇਸ਼ IgG ਐਂਟੀਬਾਡੀ ਸ਼ੁੱਧੀਕਰਨ

ਇਸ ਅਧਿਐਨ ਵਿੱਚ ਵਰਤੇ ਗਏ ਸੀਰਮ ਦੇ ਨਮੂਨੇ ਅੱਠ ਤੋਂ ਇਕੱਠੇ ਕੀਤੇ ਗਏ ਸਨ ਪੀ. vivax-ਰੋਚ ਦੇ ਖਾਸ ਐਂਟੀਜੇਨ ਲਈ ਉੱਚ ਪ੍ਰਤੀਕਿਰਿਆ ਦੇ ਨਾਲ ROK ਤੋਂ ਸੰਕਰਮਿਤ ਮਰੀਜ਼, ਜਿਸਦੀ ਪ੍ਰੋਟੀਨ ਮਾਈਕ੍ਰੋਏਰੇ ਨਾਲ ਇਮਯੂਨੋਸਕ੍ਰੀਨਿੰਗ ਦੁਆਰਾ ਜਾਂਚ ਕੀਤੀ ਗਈ ਸੀ। ਨਿਯੰਤਰਣ ਵਿੱਚ ਆਰਓਕੇ ਦੇ ਇੱਕ ਗੈਰ-ਸੰਕੇਤਕ ਖੇਤਰ ਦੇ ਅੱਠ ਸਿਹਤਮੰਦ ਵਿਅਕਤੀਆਂ ਦੇ ਪੂਲਡ ਸੀਰਮ ਨਮੂਨੇ ਸ਼ਾਮਲ ਹਨ। ਨਿਰਮਾਤਾ ਦੇ ਪ੍ਰੋਟੋਕੋਲ (GE ਹੈਲਥਕੇਅਰ ਲਾਈਫ ਸਾਇੰਸਜ਼) ਦੇ ਅਨੁਸਾਰ ਪ੍ਰੋਟੀਨ G ਕਾਲਮਾਂ ਦੀ ਵਰਤੋਂ ਕਰਕੇ ਪੂਲਡ ਸੀਰਮ ਦੇ ਨਮੂਨਿਆਂ ਤੋਂ ਕੁੱਲ ਆਈਜੀਜੀ ਐਂਟੀਬਾਡੀਜ਼ ਨੂੰ ਸ਼ੁੱਧ ਕੀਤਾ ਗਿਆ ਸੀ। ਅਲੱਗ-ਥਲੱਗ ਆਈਜੀਜੀ ਐਂਟੀਬਾਡੀਜ਼ ਨੂੰ RPMI 1640 ਮਾਧਿਅਮ ਦੇ ਵਿਰੁੱਧ ਡਾਇਲਾਈਜ਼ ਕੀਤਾ ਗਿਆ ਸੀ ਅਤੇ 10 ਤੋਂ 20 mg/mL ਦੀ ਇਕਾਗਰਤਾ ਲਈ 30-kDa ਕੱਟ-ਆਫ ਮੁੱਲ ਦੇ ਨਾਲ ਸੈਂਟਰਿਫਿਊਗਲ ਡਿਵਾਈਸਾਂ (ਮਰਕ ਮਿਲੀਪੋਰ, ਡਰਮਸਟੈਡ, ਜਰਮਨੀ) ਦੀ ਵਰਤੋਂ ਕਰਕੇ ਕੇਂਦਰਿਤ ਕੀਤਾ ਗਿਆ ਸੀ। PvRBP1a, Pv41, ਅਤੇ PvRhopH2 ਰੀਕੌਂਬੀਨੈਂਟ ਪ੍ਰੋਟੀਨ (2-3 ਮਿਲੀਗ੍ਰਾਮ ਹਰੇਕ) ਨੂੰ ਨਿਰਮਾਤਾ ਦੀਆਂ ਹਦਾਇਤਾਂ ਅਨੁਸਾਰ ਸਾਈਨੋਜਨ ਬ੍ਰੋਮਾਈਡ (CNBr) - ਐਕਟੀਵੇਟਿਡ ਸੇਫਰੋਸ 4 ਫਾਸਟ ਫਲੋ ਬੀਡਜ਼ (GE ਹੈਲਥਕੇਅਰ ਲਾਈਫ ਸਾਇੰਸਜ਼) 'ਤੇ ਸਥਿਰ ਕੀਤਾ ਗਿਆ ਸੀ। ਕੁੱਲ ਅਲੱਗ-ਥਲੱਗ ਆਈਜੀਜੀ ਐਂਟੀਬਾਡੀਜ਼ (0.5 ਮਿ.ਲੀ.) ਨੂੰ ਐਂਟੀਜੇਨ ਜੋੜੇ ਮਣਕਿਆਂ ਨਾਲ ਭਰੇ ਹੋਏ ਕਾਲਮ ਵਿੱਚ ਲੋਡ ਕੀਤਾ ਗਿਆ ਸੀ ਅਤੇ ਇੱਕ ਇਲਿਊਸ਼ਨ ਬਫਰ (0.1 ਐਮ ਗਲਾਈਸੀਨ, pH 2.7) ਦੀ ਵਰਤੋਂ ਕਰਕੇ ਅਲਟ ਕੀਤਾ ਗਿਆ ਸੀ। ਐਲੀਟਿਡ ਐਂਟੀਜੇਨ-ਵਿਸ਼ੇਸ਼ IgGs ਨੂੰ ਤੁਰੰਤ ਟ੍ਰਿਸ ਬਫਰ (pH 9.0) ਨਾਲ ਨਿਰਪੱਖ ਕੀਤਾ ਗਿਆ ਸੀ ਅਤੇ ਅਧੂਰੀ RPMI 1640 ਮਾਧਿਅਮ ਤੋਂ ਲੋੜੀਂਦੀ ਇਕਾਗਰਤਾ ਦੇ ਵਿਰੁੱਧ ਡਾਇਲਾਈਜ਼ ਕੀਤਾ ਗਿਆ ਸੀ।

ਇਮਯੂਨੋਫਲੋਰੋਸੈਂਸ ਅਸੇ (IFA)

ਇੱਕ IFA ਕੀਤਾ ਗਿਆ ਸੀ ਜਿਵੇਂ ਕਿ ਪਹਿਲਾਂ ਦੱਸਿਆ ਗਿਆ ਸੀ [47]। ਸਲਾਈਡਾਂ ਨੂੰ ਖਰਗੋਸ਼ ਪੌਲੀਕਲੋਨਲ ਸੀਰਮ ਦੇ ਇੱਕ ਪੈਨਲ ਨਾਲ ਦੋਹਰੀ ਜਾਂਚ ਕੀਤੀ ਗਈ ਸੀ ਪੀ. vivax ਐਂਟੀਜੇਨਸ (1:50) ਅਤੇ ਮਾਊਸ ਸੀਰਮ ਦੇ ਵਿਰੁੱਧ ਪੀ. knowlesi ਸਥਾਨਕਕਰਨ ਮਾਰਕਰ ਵਜੋਂ ਐਂਟੀਜੇਨਜ਼ (ਮੇਰੋਜ਼ੋਇਟ ਸਤਹ ਲਈ PkMSP1-19, ਮਾਈਕ੍ਰੋਨੇਮ ਲਈ PkDBPα-II, ਅਤੇ ਰੋਪਟਰੀ 1:50 ਲਈ PkRhopH2)। ਅਲੈਕਸਾ ਫਲੋਰ 488 ਬੱਕਰੀ ਵਿਰੋਧੀ ਮਾਊਸ IgG (H+L) ਅਤੇ ਅਲੈਕਸਾ ਫਲੋਰ 568 ਬੱਕਰੀ-ਵਿਰੋਧੀ ਖਰਗੋਸ਼ IgG (H+L) ਨੂੰ ਸੈਕੰਡਰੀ ਐਂਟੀਬਾਡੀਜ਼ ਵਜੋਂ ਵਰਤਿਆ ਗਿਆ ਸੀ। ਨਿਊਕਲੀਅਸ ਨੂੰ 4’,6-ਡਿਆਮੀਡੀਨੋ-2-ਫੇਨਿਲਿੰਡੋਲ (DAPI, ਇਨਵਿਟ੍ਰੋਜਨ) ਨਾਲ ਰੰਗਿਆ ਗਿਆ ਸੀ। ਇਮੇਜਜੇ ਦੁਆਰਾ ਲਾਲ ਅਤੇ ਹਰੇ ਪਿਕਸਲ ਦੀ ਤੀਬਰਤਾ ਦਾ ਵਿਸ਼ਲੇਸ਼ਣ ਕੀਤਾ ਗਿਆ ਸੀ. ਵਿਅਕਤੀਗਤ ਲਾਲ ਅਤੇ ਹਰੇ ਪਿਕਸਲ ਤੀਬਰਤਾ ਦੇ ਸਕੈਟਰ ਪਲਾਟਾਂ ਦੀ ਫਿਰ ਤੁਲਨਾ ਕੀਤੀ ਗਈ ਅਤੇ ਨਿਰਧਾਰਨ ਦੇ ਗੁਣਾਂਕ (ਆਰ-ਵਰਗ) ਪ੍ਰਾਪਤ ਕੀਤਾ ਗਿਆ ਸੀ। ਵੱਡਾ ਆਰ-ਵਰਗ (100% ਦੇ ਨੇੜੇ) ਰਿਗਰੈਸ਼ਨ ਲਾਈਨ ਦੇ ਆਲੇ ਦੁਆਲੇ ਸਕੈਟਰ ਮੁੱਲ ਨੂੰ ਦਰਸਾਉਂਦਾ ਹੈ ਜੋ ਇਸਦੇ ਮੱਧਮਾਨ ਦੇ ਆਲੇ ਦੁਆਲੇ ਲਾਲ ਅਤੇ ਹਰੇ ਪਿਕਸਲ ਤੀਬਰਤਾ ਦੀ ਪਰਿਵਰਤਨ ਦਾ ਸੁਝਾਅ ਦਿੰਦਾ ਹੈ। ਸਮੂਹੀਕਰਨ ਨੂੰ ਲਾਲ (ਨਿਯੰਤਰਣ) ਅਤੇ ਹਰੇ ਪਿਕਸਲ ਤੀਬਰਤਾ ਦੇ ਵਿਚਕਾਰ ਸਥਾਨਿਕ ਓਵਰਲੈਪ ਵਜੋਂ ਨਿਰਧਾਰਤ ਕੀਤਾ ਗਿਆ ਸੀ ਜਿਵੇਂ ਕਿ ਵੱਡੇ ਵਿੱਚ ਦਿਖਾਇਆ ਗਿਆ ਹੈ ਆਰ-ਵਰਗ ਮੁੱਲ।

ਪ੍ਰੋਟੀਨ ਮਾਈਕ੍ਰੋਏਰੇ

ਪ੍ਰੋਟੀਨ ਮਾਈਕ੍ਰੋਏਰੇ ਪ੍ਰੋਟੋਕੋਲ ਦਾ ਵਰਣਨ ਕਿਤੇ ਹੋਰ ਕੀਤਾ ਗਿਆ ਸੀ [25]. ਸੀਰਮ ਅੱਠ ਤੋਂ ਪੂਲ ਕੀਤਾ ਗਿਆ ਸੀ ਪੀ. vivax- ਅਤੇ ਪੀ. ਜਾਨਲੇਸੀ-ਸੰਕਰਮਿਤ ਮਰੀਜ਼, ਸਿਹਤਮੰਦ ਦਾਨੀਆਂ ਅਤੇ/ਜਾਂ ਵਿਅਕਤੀਗਤ ਤੌਰ 'ਤੇ ਕ੍ਰਾਸ-ਇਮਿਊਨੋਰਐਕਟੀਵਿਟੀ ਦਾ ਮੁਲਾਂਕਣ ਕਰਨ ਲਈ ਪੂਲਿੰਗ ਤੋਂ ਬਿਨਾਂ ਵਰਤਿਆ ਜਾਂਦਾ ਹੈ। ਪੂਲਡ ਜਾਂ ਵਿਅਕਤੀਗਤ ਪੀ. vivax- ਜਾਂ ਪੀ. knowlesi- ਸੰਕਰਮਿਤ ਮਰੀਜ਼ ਦੇ ਸੀਰਮ ਜਾਂ ਸਿਹਤਮੰਦ ਸੀਰਮ ਨੂੰ 1:25 ਦੇ ਰੂਪ ਵਿੱਚ ਪੇਤਲਾ ਕੀਤਾ ਗਿਆ ਸੀ। ਕੱਟ-ਆਫ ਮੁੱਲ ਨੈਗੇਟਿਵ ਨਮੂਨਿਆਂ ਦੇ ਔਸਤ ਫਲੋਰੋਸੈਂਸ ਤੀਬਰਤਾ (MFI) ਪਲੱਸ ਦੋ ਸਟੈਂਡਰਡ ਡਿਵੀਏਸ਼ਨ (SDs) ਦੇ ਬਰਾਬਰ ਸੀ। ਸਧਾਰਣ MFI ਮੁੱਲਾਂ ਦੀ ਗਣਨਾ MFI/ਕਟ-ਆਫ ਮੁੱਲਾਂ ਤੋਂ ਕੀਤੀ ਗਈ ਸੀ। ਪੂਲਡ ਮਰੀਜ਼ ਸੀਰਮ ਲਈ ਸਧਾਰਣ MFI ਨੂੰ ਪੂਲਡ ਸਿਹਤਮੰਦ ਸੀਰਮ ਲਈ ਅਨੁਸਾਰੀ ਆਮ MFI ਤੋਂ ਘਟਾ ਦਿੱਤਾ ਗਿਆ ਸੀ।

ਵਿਕਾਸ ਰੋਕਣ ਦੀ ਪਰਖ

ਹਮਲਾ ਰੋਕੂ ਪਰਖ ਲਈ ਪ੍ਰਮਾਣਿਤ ਪ੍ਰੋਟੋਕੋਲ ਨੂੰ ਕਿਤੇ ਹੋਰ ਵਰਣਨ ਕੀਤਾ ਗਿਆ ਹੈ [47]. ਸੰਖੇਪ ਰੂਪ ਵਿੱਚ, 2 mg/mL ਸ਼ੁੱਧ ਖਰਗੋਸ਼ IgG ਐਂਟੀਬਾਡੀਜ਼, ਅਤੇ ਮਰੀਜ਼ਾਂ (0.1, 0.2, ਅਤੇ 0.5 mg/mL) ਤੋਂ ਐਂਟੀਜੇਨ-ਵਿਸ਼ੇਸ਼ IgG ਐਂਟੀਬਾਡੀਜ਼ ਦੀ ਇਕਾਗਰਤਾ ਗਰੇਡੀਏਂਟ ਨੂੰ ਇੱਕ 96-ਵੈਲ ਕਲਚਰ ਪਲੇਟ ਵਿੱਚ ਸ਼ਾਮਲ ਕੀਤਾ ਗਿਆ ਸੀ। ਪੀ. knowlesi ਤਾਜ਼ੇ ਮਨੁੱਖੀ ਏਰੀਥਰੋਸਾਈਟਸ ਤੋਂ 1.5% ਸ਼ੁਰੂਆਤੀ ਪੈਰਾਸਾਈਟਮੀਆ ਅਤੇ 2% ਹੇਮਾਟੋਕ੍ਰਿਟ ਵਾਲੇ ਸਕਾਈਜ਼ੌਂਟਸ। ਇੱਕ ਐਂਟੀ-Fy6 ਮੋਨੋਕਲੋਨਲ ਐਂਟੀਬਾਡੀ (25 μg/mL), ਜੋ ਕਿ ਲਾਲ ਲਹੂ ਦੇ ਸੈੱਲ ਦੀ ਸਤਹ ਝਿੱਲੀ 'ਤੇ ਸਥਿਤ DARC N-ਟਰਮੀਨਲ ਖੇਤਰ ਵਿੱਚ 2C3 ਐਪੀਟੋਪ ਨੂੰ ਮਾਨਤਾ ਦਿੰਦਾ ਹੈ, ਪ੍ਰਾਪਤ ਕੀਤਾ ਗਿਆ ਸੀ ਜਿਵੇਂ ਕਿ ਪਹਿਲਾਂ ਦੱਸਿਆ ਗਿਆ ਸੀ [56]। ਇਹ ਐਂਟੀਬਾਡੀ ਡਾ. ਓਲੀਵੀਅਰ ਬਰਟਰੈਂਡ ਅਤੇ ਡਾ. ਯਵੇਸ ਕੋਲਿਨ (ਇੰਸਟੀਟਿਊਟ ਨੈਸ਼ਨਲ ਡੇ ਲਾ ਟਰਾਂਸਫਿਊਜ਼ਨ ਸੈਂਗੁਇਨ, ਪੈਰਿਸ, ਫਰਾਂਸ) ਵੱਲੋਂ ਇੱਕ ਕਿਸਮ ਦਾ ਤੋਹਫ਼ਾ ਸੀ। ਲਈ ਪੋਸਟ-ਹਮਲੇ ਦੇ 10 ਘੰਟੇ ਬਾਅਦ ਪੀ. knowlesi, ਪਰਜੀਵੀਆਂ ਨੂੰ SYBR ਗ੍ਰੀਨ I (ਸਿਗਮਾ-ਐਲਡਰਚ) ਨਾਲ ਰੰਗਿਆ ਗਿਆ ਸੀ ਅਤੇ ਇੱਕ Accuri C6 ਫਲੋ ਸਾਈਟੋਮੀਟਰ (Accuri cytometer Inc., Ann Arbor, MI) ਨਾਲ ਵਿਸ਼ਲੇਸ਼ਣ ਕੀਤਾ ਗਿਆ ਸੀ। ਦੋ ਸੁਤੰਤਰ ਪ੍ਰਯੋਗ ਡੁਪਲੀਕੇਟ ਵਿੱਚ ਕੀਤੇ ਗਏ ਸਨ ਡੁਪਲੀਕੇਟ ਵਿੱਚ ਤਿੰਨ ਸੁਤੰਤਰ ਪ੍ਰਯੋਗ ਸੀਮਤ ਐਂਟੀਬਾਡੀ ਮਾਤਰਾ ਦੇ ਕਾਰਨ ਸੰਭਵ ਨਹੀਂ ਸਨ।

ਡਾਟਾ ਦਾ ਵਿਸ਼ਲੇਸ਼ਣ

ਸਾਰੀਆਂ ਗਣਨਾਵਾਂ ਅਤੇ ਡੇਟਾ ਵਿਸ਼ਲੇਸ਼ਣ ਗ੍ਰਾਫਪੈਡ PRISM 5 (ਗ੍ਰਾਫਪੈਡ ਸੌਫਟਵੇਅਰ, ਇੰਕ., ਸੈਨ ਡਿਏਗੋ, CA) ਨਾਲ ਕੀਤੇ ਗਏ ਸਨ। ਮਾਨ-ਵਿਟਨੀ ਟੈਸਟ ਦੀ ਵਰਤੋਂ ਸਾਧਨਾਂ ਵਿਚਕਾਰ ਅੰਤਰਾਂ ਦਾ ਮੁਲਾਂਕਣ ਕਰਨ ਲਈ ਕੀਤੀ ਗਈ ਸੀ, ਅਤੇ ਡਨੇਟ ਦੇ ਟੈਸਟ ਦੇ ਨਾਲ ਇੱਕ ਤਰਫਾ ਅਨੋਵਾ ਦੀ ਵਰਤੋਂ ਨਿਯੰਤਰਣ ਐਂਟੀ-HisGST 95% ਭਰੋਸੇ ਅੰਤਰਾਲ (CIs) ਵਾਲੇ ਦੋ ਤੋਂ ਵੱਧ ਸਮੂਹਾਂ ਦੇ ਸਾਧਨਾਂ ਦੀ ਤੁਲਨਾ ਕਰਨ ਲਈ ਕੀਤੀ ਗਈ ਸੀ, ਅਤੇ ਪੀ < 0.05 ਨੂੰ ਮਹੱਤਵਪੂਰਨ ਮੰਨਿਆ ਗਿਆ ਸੀ। 50% ਨਿਰੋਧਕ ਇਕਾਗਰਤਾ (IC50) ਲੌਗ-ਪਰਿਵਰਤਿਤ ਐਂਟੀਬਾਡੀ ਗਾੜ੍ਹਾਪਣ ਦੇ ਵਿਰੁੱਧ ਸਾਜ਼ਿਸ਼ ਕੀਤੀ ਗਈ ਸੀ, ਅਤੇ ਐਕਸਲ ਸੌਫਟਵੇਅਰ ਨਾਲ ਗੈਰ-ਰੇਖਿਕ ਰੀਗਰੈਸ਼ਨ ਦੁਆਰਾ ਕਰਵ ਫਿਟਿੰਗ ਦੀ ਵਰਤੋਂ 50% ਪੈਰਾਸਾਈਟ ਵਿਕਾਸ ਰੋਕਣ ਲਈ ਕੀਤੀ ਗਈ ਸੀ। ਲੜੀਵਾਰ ਕਲੱਸਟਰਿੰਗ ਦੀ ਵਰਤੋਂ TIGR ਮਲਟੀਅਰਰੇ ਪ੍ਰਯੋਗ ਦਰਸ਼ਕ (MeV) ਸੌਫਟਵੇਅਰ [57] ਦੀ ਵਰਤੋਂ ਕਰਦੇ ਹੋਏ ਵਿਅਕਤੀਗਤ ਸੇਰੋਪੋਜ਼ਿਟਿਵਿਟੀ ਦੇ ਪ੍ਰੋਫਾਈਲ ਦੀ ਗਣਨਾ ਕਰਨ ਲਈ ਕੀਤੀ ਗਈ ਸੀ। ਕਲੱਸਟਰਿੰਗ ਵਿਸ਼ਲੇਸ਼ਣ ਇੱਕ ਸਮਾਨਤਾ ਮੈਟ੍ਰਿਕ ਦੇ ਰੂਪ ਵਿੱਚ ਯੂਕਲੀਡੀਅਨ ਦੂਰੀ ਦੇ ਨਾਲ ਔਸਤ ਲਿੰਕੇਜ ਕਲੱਸਟਰਿੰਗ ਦੀ ਵਰਤੋਂ ਕਰਕੇ ਕੀਤਾ ਗਿਆ ਸੀ।


ਕਰਾਸ-ਸਪੀਸੀਜ਼ ਇਨਫੈਕਸ਼ਨ ਅਤੇ ਉਨ੍ਹਾਂ ਦਾ ਵਿਸ਼ਲੇਸ਼ਣ

ਸਾਰਕਈ ਮੇਜ਼ਬਾਨਾਂ ਨੂੰ ਸੰਕਰਮਿਤ ਕਰਨ ਲਈ ਕੁਝ ਜਰਾਸੀਮਾਂ ਦੀ ਯੋਗਤਾ ਨੇ ਇਹਨਾਂ ਜਰਾਸੀਮ ਅਤੇ ਉਹਨਾਂ ਦੇ ਮੇਜ਼ਬਾਨਾਂ ਵਿਚਕਾਰ ਪਰਸਪਰ ਪ੍ਰਭਾਵ ਦੇ ਅਣੂ ਵਿਧੀਆਂ ਨੂੰ ਸਪੱਸ਼ਟ ਕਰਨ ਲਈ ਜੈਨੇਟਿਕ ਤੌਰ 'ਤੇ ਟ੍ਰੈਕਟੇਬਲ ਗੈਰ-ਵਰਟੀਬ੍ਰੇਟ ਮੇਜ਼ਬਾਨਾਂ ਦੇ ਵਿਕਾਸ ਵੱਲ ਅਗਵਾਈ ਕੀਤੀ ਹੈ। ਮਨੁੱਖੀ ਜਰਾਸੀਮਾਂ ਦਾ ਅਧਿਐਨ ਕਰਨ ਲਈ ਪੌਦੇ, ਕੀੜੇ, ਨੈਮਾਟੋਡ, ਅਤੇ ਪ੍ਰੋਟੋਜੋਆਨ ਮੇਜ਼ਬਾਨਾਂ ਦੀ ਵਰਤੋਂ ਨੇ ਜਰਾਸੀਮ ਅਤੇ ਮੇਜ਼ਬਾਨ ਪ੍ਰਤੀਕ੍ਰਿਆਵਾਂ ਦੇ ਅਣੂ ਪ੍ਰਕਿਰਤੀ ਦੀ ਵਿਆਖਿਆ ਦੀ ਸਹੂਲਤ ਦਿੱਤੀ ਹੈ। ਆਪਣੇ-ਆਪਣੇ ਮੇਜ਼ਬਾਨਾਂ 'ਤੇ ਮਲਟੀਹੋਸਟ ਜਰਾਸੀਮ ਦੇ ਵਾਇਰਲੈਂਸ ਦੇ ਵਿਸ਼ਲੇਸ਼ਣ ਤੋਂ ਪਤਾ ਲੱਗਾ ਹੈ ਕਿ ਜਰਾਸੀਮ ਮੇਜ਼ਬਾਨ ਦੇ ਵਿਕਾਸਵਾਦੀ ਵੰਸ਼ ਦੀ ਪਰਵਾਹ ਕੀਤੇ ਬਿਨਾਂ, ਮੇਜ਼ਬਾਨ ਬਚਾਅ ਨੂੰ ਦੂਰ ਕਰਨ ਲਈ ਬਹੁਤ ਸਾਰੀਆਂ ਵਿਆਪਕ ਅਪਮਾਨਜਨਕ ਰਣਨੀਤੀਆਂ ਦੀ ਵਰਤੋਂ ਕਰਦੇ ਹਨ। ਇਸੇ ਤਰ੍ਹਾਂ, ਗੈਰ-ਵਰਟੀਬ੍ਰੇਟ ਮੇਜ਼ਬਾਨਾਂ ਦੇ ਬਚਾਅ ਪ੍ਰਤੀਕ੍ਰਿਆ ਦੇ ਜੈਨੇਟਿਕ ਵਿਭਾਜਨ ਨੇ ਇਹ ਵੀ ਦਿਖਾਇਆ ਹੈ ਕਿ ਮੇਜ਼ਬਾਨ ਰੱਖਿਆ ਪ੍ਰਤੀਕ੍ਰਿਆਵਾਂ ਦੇ ਅਧੀਨ ਮੁੱਖ ਵਿਸ਼ੇਸ਼ਤਾਵਾਂ ਬਹੁਤ ਜ਼ਿਆਦਾ ਸੁਰੱਖਿਅਤ ਹਨ। ਇਹ ਸਮੀਖਿਆ ਇਸ ਗੱਲ ਦਾ ਸਾਰ ਦਿੰਦੀ ਹੈ ਕਿ ਕਿਵੇਂ ਕਰਾਸ-ਸਪੀਸੀਜ਼ ਇਨਫੈਕਸ਼ਨਾਂ ਦੇ ਵਿਸ਼ਲੇਸ਼ਣ ਤੋਂ ਪ੍ਰਾਪਤ ਜਾਣਕਾਰੀ ਮੇਜ਼ਬਾਨ-ਪਾਥੋਜਨ ਪਰਸਪਰ ਕ੍ਰਿਆਵਾਂ ਦੀ ਸਾਡੀ ਸਮਝ ਵਿੱਚ ਯੋਗਦਾਨ ਪਾਉਂਦੀ ਹੈ।


4 ਚਰਚਾ

ਇਸ ਅਧਿਐਨ ਵਿੱਚ, ਅਸੀਂ ਵੱਖ-ਵੱਖ ਭੂਗੋਲਿਕ ਸਥਾਨਾਂ ਤੋਂ ਪ੍ਰਾਪਤ ਕੀਤੇ ਕੋਰੋਨਵਾਇਰਸ ਦੇ 272 ਜੀਨੋਮਿਕ ਕ੍ਰਮਾਂ ਦੀ ਵਰਤੋਂ ਕਰਕੇ ਇੱਕ ਵਿਕਾਸਵਾਦੀ ਵਿਸ਼ਲੇਸ਼ਣ ਕੀਤਾ ਹੈ। ਸਾਡੇ ਨਤੀਜੇ ਦਰਸਾਉਂਦੇ ਹਨ ਕਿ ਵੁਹਾਨ ਸ਼ਹਿਰ ਵਿੱਚ ਵਾਇਰਲ ਨਮੂਨੀਆ ਦੇ ਪ੍ਰਕੋਪ ਤੋਂ ਪ੍ਰਾਪਤ ਨਾਵਲ ਕੋਰੋਨਾਵਾਇਰਸ ਕ੍ਰਮ ਇੱਕ ਵੱਖਰਾ ਸਮੂਹ ਬਣਾਉਂਦਾ ਹੈ ਜੋ SARS-CoV ਲਈ ਬਹੁਤ ਹੀ ਵੱਖਰਾ ਹੈ। SARS-CoV ਪਹਿਲੀ ਵਾਰ 2002 ਵਿੱਚ ਚੀਨ ਵਿੱਚ ਉੱਭਰਿਆ ਅਤੇ ਫਿਰ 2003 ਵਿੱਚ 37 ਦੇਸ਼ਾਂ/ਖੇਤਰਾਂ ਵਿੱਚ ਫੈਲਿਆ ਅਤੇ 9.6% ਮੌਤ ਦਰ ਦੇ ਨਾਲ ਇੱਕ ਯਾਤਰਾ-ਸਬੰਧਤ ਵਿਸ਼ਵਵਿਆਪੀ ਪ੍ਰਕੋਪ ਦਾ ਕਾਰਨ ਬਣਿਆ। 26 ਇਸ ਤੋਂ ਵੀ ਮਹੱਤਵਪੂਰਨ ਗੱਲ ਇਹ ਹੈ ਕਿ, ਸਾਡੇ ਵਿਸ਼ਲੇਸ਼ਣ ਦੇ ਨਤੀਜਿਆਂ ਤੋਂ ਪਤਾ ਲੱਗਦਾ ਹੈ ਕਿ ਵਾਇਰਲ ਸਪਾਈਕ ਗਲਾਈਕੋਪ੍ਰੋਟੀਨ ਜੀਨ ਦੇ ਅੰਦਰ ਬੈਟ ਕੋਰੋਨਾਵਾਇਰਸ ਅਤੇ ਇੱਕ ਮੂਲ-ਅਣਜਾਣ ਕੋਰੋਨਾਵਾਇਰਸ ਵਿਚਕਾਰ ਇੱਕ ਸਮਰੂਪ ਪੁਨਰ-ਸੰਯੋਜਨ ਹੋ ਸਕਦਾ ਹੈ। 2019-nCoV ਤੋਂ ਅੰਸ਼ਕ ਸਪਾਈਕ ਗਲਾਈਕੋਪ੍ਰੋਟੀਨ ਜੀਨਾਂ (1-783 bp) ਦਾ ਕ੍ਰਮ ਸਮਰੂਪ ਵਿਸ਼ਲੇਸ਼ਣ NCBI ਵੈਬਸਾਈਟ 'ਤੇ BLAST ਦੁਆਰਾ ਕੀਤਾ ਗਿਆ ਸੀ। ਦਿਲਚਸਪ ਗੱਲ ਇਹ ਹੈ ਕਿ, ਡੇਟਾਬੇਸ ਵਿੱਚ ਜਾਣੇ-ਪਛਾਣੇ ਕ੍ਰਮ ਦੇ ਨਾਲ ਕੋਈ ਸਮਾਨ ਕ੍ਰਮ ਨਹੀਂ ਮਿਲਿਆ, ਜੋ ਸੁਝਾਅ ਦਿੰਦਾ ਹੈ ਕਿ ਇੱਕ ਪੁਨਰ-ਸੰਯੋਜਨ ਮੂਲ ਵਾਇਰਸ ਅਜੇ ਵੀ ਅਣਜਾਣ ਸੀ। ਪਿਛਲੇ ਅਧਿਐਨ ਨੇ ਸੁਝਾਅ ਦਿੱਤਾ ਸੀ ਕਿ ਸਪਾਈਕ ਗਲਾਈਕੋਪ੍ਰੋਟੀਨ ਜੀਨਾਂ ਵਿੱਚ ਸਾਰਸ ਦੇ ਮੁੜ ਸੰਯੋਜਨ ਨੇ ਚਮਗਿੱਦੜਾਂ ਤੋਂ ਦੂਜੇ ਥਣਧਾਰੀ ਜੀਵਾਂ ਵਿੱਚ ਸ਼ੁਰੂਆਤੀ ਅੰਤਰ-ਸਪੀਸੀਜ਼ ਪ੍ਰਸਾਰਣ ਘਟਨਾ ਵਿੱਚ ਵਿਚੋਲਗੀ ਕੀਤੀ ਹੋ ਸਕਦੀ ਹੈ। 27 ਬੂਟਸਕੈਨਿੰਗ ਪਲਾਟ ਵਿਸ਼ਲੇਸ਼ਣ (ਡਾਟਾ ਨਹੀਂ ਦਿਖਾਇਆ ਗਿਆ) ਨੇ ਸੁਝਾਅ ਦਿੱਤਾ ਕਿ 2019-nCoV ਦੇ ਮੁੱਖ ਮਾਤਾ-ਪਿਤਾ Clade A (bat-SL-CoVZC45 ਅਤੇ bat-SL-CoVZXC21) ਤੋਂ ਉਤਪੰਨ ਹੋਏ ਪਰ ਉਹਨਾਂ ਤੋਂ ਵੱਖਰਾ ਇੱਕ ਮੋਨੋਫਾਈਲੈਟਿਕ ਕਲੱਸਟਰ ਬਣਾਇਆ। ਕੁੱਲ ਮਿਲਾ ਕੇ, 2019-nCoV ਦੀ ਜੱਦੀ ਉਤਪਤੀ SARS-CoV ਦੀ ਬਜਾਏ ਵਿਭਿੰਨ ਹੋਸਟ ਸਪੀਸੀਜ਼ ਤੋਂ ਜ਼ਿਆਦਾ ਸੰਭਾਵਨਾ ਸੀ।

ਕੁਝ ਜਾਨਵਰਾਂ ਦੇ ਕੋਰੋਨਵਾਇਰਸ ਦੀ ਮੇਜ਼ਬਾਨੀ ਸੀਮਾ ਬਹੁਤ ਜ਼ਿਆਦਾ ਸੀ। 7 ਉਹਨਾਂ ਨੇ ਸਾਡਾ ਧਿਆਨ ਉਦੋਂ ਹੀ ਖਿੱਚਿਆ ਜਦੋਂ ਉਹਨਾਂ ਨੇ ਸਾਰਸ, MERS, ਅਤੇ 2019-nCoV ਨਿਮੋਨੀਆ ਵਰਗੀਆਂ ਮਨੁੱਖੀ ਬਿਮਾਰੀਆਂ ਦਾ ਕਾਰਨ ਬਣਾਇਆ। 4, 9, 28 2019-nCoV ਦੇ ਜਾਨਵਰਾਂ ਦੇ ਭੰਡਾਰ ਨੂੰ ਨਿਰਧਾਰਤ ਕਰਨਾ ਮਹੱਤਵਪੂਰਨ ਹੈ ਤਾਂ ਜੋ ਇਸ ਦੀਆਂ ਕਰਾਸ-ਸਪੀਸੀਜ਼ ਫੈਲਣ ਦੀ ਅਣੂ ਵਿਧੀ ਨੂੰ ਸਮਝਿਆ ਜਾ ਸਕੇ। ਵੱਖ-ਵੱਖ ਮੇਜ਼ਬਾਨਾਂ ਦੇ ਕੋਰੋਨਵਾਇਰਸ ਵਿਚਕਾਰ ਵਾਇਰਲ ਸਟ੍ਰਕਚਰਲ ਪ੍ਰੋਟੀਨ ਦੇ ਅੰਦਰ ਸਮਰੂਪ ਪੁਨਰ-ਸੰਯੋਜਨ "ਕਰਾਸ-ਸਪੀਸੀਜ਼" ਪ੍ਰਸਾਰਣ ਲਈ ਜ਼ਿੰਮੇਵਾਰ ਹੋ ਸਕਦਾ ਹੈ। 27 RSCU ਵਿਸ਼ਲੇਸ਼ਣ ਤੋਂ ਪ੍ਰਾਪਤ ਜਾਣਕਾਰੀ ਜੰਗਲੀ ਜੀਵ ਜਾਨਵਰਾਂ ਦੇ ਭੰਡਾਰ ਦੇ ਸਵਾਲ ਲਈ ਕੁਝ ਸਮਝ ਪ੍ਰਦਾਨ ਕਰਦੀ ਹੈ ਹਾਲਾਂਕਿ ਇਸ ਨੂੰ ਜਾਨਵਰਾਂ ਦੇ ਮਾਡਲਾਂ ਵਿੱਚ ਪ੍ਰਯੋਗਾਤਮਕ ਅਧਿਐਨਾਂ ਦੁਆਰਾ ਹੋਰ ਪ੍ਰਮਾਣਿਕਤਾ ਦੀ ਲੋੜ ਹੁੰਦੀ ਹੈ। ਵਰਤਮਾਨ ਵਿੱਚ, 2019-nCoV ਨੂੰ ਜਾਨਵਰਾਂ ਦੀਆਂ ਕਿਸਮਾਂ ਤੋਂ ਅਲੱਗ ਨਹੀਂ ਕੀਤਾ ਗਿਆ ਹੈ ਹਾਲਾਂਕਿ ਇਹ ਇੱਕ ਮਰੀਜ਼ ਤੋਂ ਪ੍ਰਾਪਤ ਕੀਤਾ ਗਿਆ ਸੀ। 2019-nCoV ਲਈ ਜਾਨਵਰਾਂ ਦੇ ਭੰਡਾਰ ਦੀ ਪਛਾਣ ਅਤੇ ਵਿਸ਼ੇਸ਼ਤਾ ਪੁਨਰ-ਸੰਯੋਜਨ ਦੀ ਜਾਂਚ ਅਤੇ ਮਨੁੱਖੀ ਆਬਾਦੀ ਵਿੱਚ ਫੈਲੇ ਇਸ ਦੇ ਵਿਅਕਤੀ-ਤੋਂ-ਵਿਅਕਤੀ ਦੀ ਬਿਹਤਰ ਸਮਝ ਲਈ ਮਦਦਗਾਰ ਹੋਵੇਗਾ।

2019-nCoV ਨੇ ਚੀਨ ਵਿੱਚ 20 ਜਨਵਰੀ 2020 ਤੱਕ ਨਿਮੋਨੀਆ ਦੇ ਕੁੱਲ 217 ਪੁਸ਼ਟੀ ਕੀਤੇ ਕੇਸਾਂ ਦਾ ਕਾਰਨ ਹਾਂਗਕਾਂਗ, ਥਾਈਲੈਂਡ, ਸਿੰਗਾਪੁਰ, ਦੱਖਣੀ ਕੋਰੀਆ ਅਤੇ ਜਾਪਾਨ ਵਿੱਚ ਵੀ ਨਵੇਂ ਮਰੀਜ਼ ਸਾਹਮਣੇ ਆਏ ਹਨ। SARS-CoV ਦੇ ਉਲਟ, 2019-nCoV ਸ਼ੁਰੂ ਵਿੱਚ ਵਾਇਰਲ ਨਮੂਨੀਆ ਦੇ ਇੱਕ ਹਲਕੇ ਰੂਪ ਦਾ ਕਾਰਨ ਬਣਦਾ ਦਿਖਾਈ ਦਿੱਤਾ ਅਤੇ ਵਿਅਕਤੀ-ਵਿਅਕਤੀ ਵਿੱਚ ਫੈਲਣ ਦੀ ਸੀਮਤ ਸਮਰੱਥਾ ਹੈ। ਇਹ ਰੀਸੈਪਟਰ-ਬਾਈਡਿੰਗ ਗਲਾਈਕੋਪ੍ਰੋਟੀਨ ਦੇ ਅੰਦਰ ਮੁੜ ਸੰਯੋਜਨ ਦੇ ਕਾਰਨ ਹੋ ਸਕਦਾ ਹੈ। ਹਾਲਾਂਕਿ, ਮਨੁੱਖਾਂ ਵਿੱਚ ਇਸਦੇ ਅਨੁਕੂਲਨ ਬਾਰੇ ਚਿੰਤਾ ਹੈ ਜੋ ਵਧੇਰੇ ਕੁਸ਼ਲਤਾ ਨਾਲ ਨਕਲ ਕਰਨ ਅਤੇ ਨਜ਼ਦੀਕੀ ਵਿਅਕਤੀ-ਵਿਅਕਤੀ ਦੇ ਸੰਪਰਕ ਦੁਆਰਾ ਵਧੇਰੇ ਤੇਜ਼ੀ ਨਾਲ ਫੈਲਣ ਦੀ ਸਮਰੱਥਾ ਪ੍ਰਾਪਤ ਕਰ ਸਕਦੀ ਹੈ।

ਸੰਖੇਪ ਰੂਪ ਵਿੱਚ, ਸਾਡੇ ਵਿਕਾਸਵਾਦੀ ਵਿਸ਼ਲੇਸ਼ਣ ਤੋਂ ਲਏ ਗਏ ਨਤੀਜੇ ਸੁਝਾਅ ਦਿੰਦੇ ਹਨ ਕਿ 2019-nCoV ਵਿੱਚ ਬੈਟ ਕੋਰੋਨੋਵਾਇਰਸ ਨਾਲ ਸਭ ਤੋਂ ਮਿਲਦੀ ਜੁਲਦੀ ਜੈਨੇਟਿਕ ਜਾਣਕਾਰੀ ਹੈ ਅਤੇ ਸੱਪ ਦੇ ਨਾਲ ਕੋਡੋਨ ਦੀ ਵਰਤੋਂ ਦਾ ਸਭ ਤੋਂ ਸਮਾਨ ਪੱਖਪਾਤ ਹੈ। ਇਸ ਤੋਂ ਇਲਾਵਾ, ਵਾਇਰਲ ਰੀਸੈਪਟਰ-ਬਾਈਡਿੰਗ ਸਪਾਈਕ ਗਲਾਈਕੋਪ੍ਰੋਟੀਨ ਦੇ ਅੰਦਰ ਇੱਕ ਸਮਰੂਪ ਪੁਨਰ-ਸੰਯੋਜਨ ਹੋ ਸਕਦਾ ਹੈ, ਜੋ ਕਰਾਸ-ਸਪੀਸੀਜ਼ ਟ੍ਰਾਂਸਮਿਸ਼ਨ ਨੂੰ ਨਿਰਧਾਰਤ ਕਰ ਸਕਦਾ ਹੈ। ਇਹ ਨਾਵਲ ਖੋਜਾਂ ਪ੍ਰਯੋਗਾਤਮਕ ਤੌਰ 'ਤੇ ਇਹ ਨਿਰਧਾਰਤ ਕਰਨ ਲਈ ਭਵਿੱਖ ਦੀ ਜਾਂਚ ਦੀ ਵਾਰੰਟੀ ਦਿੰਦੀਆਂ ਹਨ ਕਿ ਕੀ ਸਪਾਈਕ ਗਲਾਈਕੋਪ੍ਰੋਟੀਨ ਦੇ ਅੰਦਰ ਸਮਰੂਪ ਪੁਨਰ-ਸੰਯੋਜਨ ਵਾਇਰਲ ਟ੍ਰਾਂਸਮਿਸ਼ਨ ਅਤੇ ਪ੍ਰਤੀਕ੍ਰਿਤੀ ਵਿੱਚ 2019-nCoV ਦੇ ਟ੍ਰੋਪਿਜ਼ਮ ਨੂੰ ਨਿਰਧਾਰਤ ਕਰਦਾ ਹੈ। ਸਾਡੇ ਵਿਕਾਸਵਾਦੀ ਵਿਸ਼ਲੇਸ਼ਣ ਤੋਂ ਪ੍ਰਾਪਤ ਨਵੀਂ ਜਾਣਕਾਰੀ 2019-nCoV-ਪ੍ਰੇਰਿਤ ਨਮੂਨੀਆ ਕਾਰਨ ਫੈਲਣ ਵਾਲੇ ਪ੍ਰਕੋਪ ਦੇ ਪ੍ਰਭਾਵੀ ਨਿਯੰਤਰਣ ਲਈ ਬਹੁਤ ਮਹੱਤਵਪੂਰਨ ਹੈ।


ਸਥਿਰਤਾ MHV ਹੋਸਟ ਰੇਂਜ ਮਿਊਟੈਂਟਸ ਦੀ ਚੋਣ ਕਰਦੀ ਹੈ।

ਚਿੱਤਰ 2. HepG2 ਸੈੱਲਾਂ ਵਿੱਚ ਲਗਾਤਾਰ ਵਾਇਰਸ ਐਂਟੀਜੇਨ ਸਮੀਕਰਨ। ਅੱਠ-ਚੈਂਬਰ ਲੈਬਟੈਕ ਚੈਂਬਰਾਂ ਵਿੱਚ HepG2 ਸੈੱਲ ਲਾਈਨਾਂ ਦੇ ਕਲਚਰ V51B (A), V10B (B), V30B (C), ਜਾਂ MHV-A59 (D) ਨਾਲ 1 ਘੰਟੇ ਲਈ 5 ਦੇ MOI 'ਤੇ ਸੰਕਰਮਿਤ ਹੋਏ ਸਨ। ਸੰਸਕ੍ਰਿਤੀਆਂ ਨੂੰ ਪੌਲੀਕਲੋਨਲ MHV-A59 ਐਂਟੀਸੀਰਮ ਨਾਲ 18 ਘੰਟਿਆਂ ਬਾਅਦ ਲਾਗ ਦੇ ਬਾਅਦ ਦਾਗ਼ ਕੀਤਾ ਗਿਆ ਸੀ।

HCEA ਐਂਟੀਸੇਰਮ ਮਨੁੱਖੀ ਸੈੱਲ ਲਾਈਨਾਂ ਵਿੱਚ ਲਗਾਤਾਰ ਵਾਇਰਸ ਦੇ ਦਾਖਲੇ ਨੂੰ ਰੋਕਦਾ ਹੈ।

ਐਂਟੀਬਾਡੀHepG2 ਸੈੱਲਾਂ ਵਿੱਚ V51B ਨਾਕਾਬੰਦੀ hCEA ਐਂਟੀਜੇਨ ਕਰਾਸ-ਰੀਐਕਟੀਵਿਟੀ ਏ
Bgp1CGM6ਐਨ.ਸੀ.ਏCGM1ਸੀ.ਈ.ਏCGM7
ਮੋਨੋਕਲੋਨਲ
ਕੋਲ-1+++
ਕੋਲ-6??+?
ਕੋਲ-12+? a ???+?
ਕੋਲ-4++++
ਕੋਲ-14+????+?
Kat4c++++
pCEA (ਪੌਲੀਕਲੋਨਲ)+++++++
ਚਿੱਤਰ 3. HepG2 ਸੈੱਲਾਂ ਵਿੱਚ ਨਾਕਾਬੰਦੀ ਪ੍ਰਯੋਗ। ਅੱਠ-ਚੈਂਬਰ ਲੈਬਟੇਕ ਸਲਾਈਡਾਂ ਵਿੱਚ HepG2 ਸੈੱਲਾਂ ਦੇ ਕਲਚਰ ਦਾ ਇਲਾਜ ਨਹੀਂ ਕੀਤਾ ਗਿਆ (w/o) ਜਾਂ ਕਮਰੇ ਦੇ ਤਾਪਮਾਨ 'ਤੇ 1 ਘੰਟੇ ਲਈ 1:4 ਪਤਲੇ ਹੋਣ 'ਤੇ hCEA ਜੀਨਾਂ ਦੇ ਵਿਰੁੱਧ ਵੱਖ-ਵੱਖ ਪੌਲੀਕਲੋਨਲ ਜਾਂ ਮੋਨੋਕਲੋਨਲ ਐਂਟੀਬਾਡੀਜ਼ ਨਾਲ ਇਲਾਜ ਕੀਤਾ ਗਿਆ। ਐਂਟੀਬਾਡੀਜ਼ ਨੂੰ ਹਟਾ ਦਿੱਤਾ ਗਿਆ ਸੀ, ਅਤੇ ਸਭਿਆਚਾਰਾਂ ਨੂੰ 1 ਘੰਟੇ ਲਈ 5 ਦੇ MOI 'ਤੇ V51B ਨਾਲ ਸੰਕਰਮਿਤ ਕੀਤਾ ਗਿਆ ਸੀ। ਵਾਇਰਸ ਇਨੋਕੁਲਮ ਨੂੰ ਹਟਾ ਦਿੱਤਾ ਗਿਆ ਸੀ, ਅਤੇ ਉਸੇ ਐਂਟੀਬਾਡੀ ਦਾ 1:20 ਪਤਲਾ ਕਰਨ ਵਾਲਾ ਪੂਰਾ ਮਾਧਿਅਮ ਚੈਂਬਰ ਵਿੱਚ ਜੋੜਿਆ ਗਿਆ ਸੀ। ਵਾਇਰਸ ਦੇ ਨਮੂਨੇ ਦਰਸਾਏ ਸਮੇਂ 'ਤੇ ਲਏ ਗਏ ਸਨ, ਅਤੇ ਵਾਇਰਸ ਟਾਇਟਰਾਂ ਨੂੰ DBT-9 ਸੈੱਲਾਂ ਵਿੱਚ ਪਲੇਕ ਪਰਖ ਦੁਆਰਾ ਨਿਰਧਾਰਤ ਕੀਤਾ ਗਿਆ ਸੀ। ਚਿੱਤਰ 4. HepG2 ਸੈੱਲਾਂ ਵਿੱਚ hCEA ਗਲਾਈਕੋਪ੍ਰੋਟੀਨ ਸਮੀਕਰਨ। HepG2 ਸੈੱਲਾਂ ਨੂੰ ਕਮਰੇ ਦੇ ਤਾਪਮਾਨ 'ਤੇ 30 ਮਿੰਟ ਲਈ ਵੱਖ-ਵੱਖ ਐਂਟੀਸੇਰਾ ਨਾਲ ਪ੍ਰੀ-ਟਰੀਟ ਕੀਤਾ ਗਿਆ ਸੀ। ਵਿਆਪਕ ਧੋਣ ਤੋਂ ਬਾਅਦ, FITC-ਸੰਯੁਕਤ ਖਰਗੋਸ਼ ਐਂਟੀ-ਮਾਊਸ IgG ਐਂਟੀਸੇਰਮ ਨੂੰ ਕਮਰੇ ਦੇ ਤਾਪਮਾਨ 'ਤੇ 30 ਮਿੰਟ ਲਈ ਜੋੜਿਆ ਗਿਆ ਸੀ। ਵਾਧੂ ਧੋਣ ਤੋਂ ਬਾਅਦ, ਸੈੱਲਾਂ ਦਾ FACS ਤਕਨੀਕਾਂ ਦੁਆਰਾ ਵਿਸ਼ਲੇਸ਼ਣ ਕੀਤਾ ਗਿਆ ਸੀ। (A) Col-1 (B) Col-12 (C) Col-14 (D) Col-6 (E) Kat4c.

ਸਥਾਈ ਵਾਇਰਸ hCEA ਗਲਾਈਕੋਪ੍ਰੋਟੀਨ ਨੂੰ ਰੀਸੈਪਟਰਾਂ ਵਜੋਂ ਮਾਨਤਾ ਦਿੰਦੇ ਹਨ।

ਚਿੱਤਰ 5 . pSinRep19 ਪ੍ਰਤੀਕ੍ਰਿਤੀਆਂ MHV ਦੀ ਲਾਗ ਨੂੰ ਨਹੀਂ ਰੋਕਦੀਆਂ। ਇਹ ਨਿਰਧਾਰਤ ਕਰਨ ਲਈ ਕਿ ਕੀ ਨਾਨਸਾਈਟੋਪੈਥਿਕ pSinRep19 ਪ੍ਰਤੀਕ੍ਰਿਤੀਆਂ MHV ਪ੍ਰਤੀਕ੍ਰਿਤੀ ਨੂੰ ਰੋਕਦੀਆਂ ਹਨ, BHK-MHVR ਸੈੱਲਾਂ ਦੇ ਕਲਚਰ ਨੂੰ pSinRep19/T7pol ਟ੍ਰਾਂਸਕ੍ਰਿਪਟਾਂ ਨਾਲ ਬਦਲਿਆ ਗਿਆ ਸੀ ਅਤੇ ਕਈ ਦਿਨਾਂ ਲਈ ਪਿਓਰੋਮਾਈਸਿਨ (5 μg/ml) ਨਾਲ ਚੁਣਿਆ ਗਿਆ ਸੀ। BHK-MHVR/SinT7pol, BHK-MHVR, ਅਤੇ BHK ਸੈੱਲਾਂ ਦੇ ਕਲਚਰ 1 ਘੰਟੇ ਲਈ 5 ਦੇ MOI 'ਤੇ MHV-A59 ਨਾਲ ਸੰਕਰਮਿਤ ਹੋਏ ਸਨ। ਵਾਇਰਸ ਦੇ ਨਮੂਨੇ ਦਰਸਾਏ ਸਮੇਂ 'ਤੇ ਲਏ ਗਏ ਸਨ ਅਤੇ ਡੀਬੀਟੀ ਸੈੱਲਾਂ ਵਿੱਚ ਪਲੇਕ ਪਰਖ ਦੁਆਰਾ ਜਾਂਚ ਕੀਤੀ ਗਈ ਸੀ। ਚਿੱਤਰ 6. BHK ਸੈੱਲਾਂ ਵਿੱਚ hCEA ਅਤੇ hBgp ਦਾ ਪ੍ਰਗਟਾਵਾ। BHK ਸੈੱਲਾਂ ਨੂੰ pSinRep19-hBgp ਅਤੇ pSinRep19-hCEA ਪ੍ਰਤੀਕ੍ਰਿਤੀਆਂ ਤੋਂ ਟ੍ਰਾਂਸਕ੍ਰਿਪਟਾਂ ਨਾਲ ਤਬਦੀਲ ਕੀਤਾ ਗਿਆ ਸੀ ਅਤੇ ਕਈ ਦਿਨਾਂ ਲਈ ਪਿਓਰੋਮਾਈਸਿਨ (5 μg/ml) ਨਾਲ ਚੁਣਿਆ ਗਿਆ ਸੀ। ਮੋਨੋਕਲੋਨਲ ਐਂਟੀਬਾਡੀ Kat4c ਦੀ ਵਰਤੋਂ ਕਰਕੇ, ਸਭਿਆਚਾਰਾਂ ਨੂੰ ਸੈੱਲ ਲਾਈਨਾਂ BHK-hBgp1 (A), BHK-hBgp1+ (B), ਅਤੇ BHK-hCEA (C) ਵਿੱਚ ਕ੍ਰਮਬੱਧ ਕੀਤਾ ਗਿਆ ਸੀ। ਇਹ ਸੈੱਲ ਲਾਈਨਾਂ hCEA ਜਾਂ hBgp ਦੇ ਮੁਕਾਬਲਤਨ ਇਕਸਾਰ ਪੱਧਰਾਂ ਨੂੰ ਦਰਸਾਉਂਦੀਆਂ ਸੈੱਲ ਲਾਈਨਾਂ ਦੇ ਵੱਡੇ ਭੰਡਾਰਾਂ ਵਿੱਚ ਉਗਾਈਆਂ ਗਈਆਂ ਸਨ। FACS ਵਿਸ਼ਲੇਸ਼ਣ ਮੋਨੋਕਲੋਨਲ ਐਂਟੀਬਾਡੀ Kat4c ਨਾਲ ਕੀਤਾ ਗਿਆ ਸੀ ਜਿਵੇਂ ਕਿ ਪਹਿਲਾਂ ਦੱਸਿਆ ਗਿਆ ਸੀ (12). ਚਿੱਤਰ 7 . HCEA ਗਲਾਈਕੋਪ੍ਰੋਟੀਨ ਨੂੰ ਦਰਸਾਉਂਦੇ BHK ਸੈੱਲਾਂ ਵਿੱਚ MHV ਪ੍ਰਤੀਕ੍ਰਿਤੀ। BHK, BHK-hCEA, BHK-hBgp1, ਅਤੇ BHK-hBgp1+ ਸੈੱਲਾਂ ਦੇ ਕਲਚਰ V51B ਜਾਂ MHV-A59 ਨਾਲ ਸੰਕਰਮਿਤ ਸਨ, ਜਿਵੇਂ ਕਿ ਦਰਸਾਏ ਗਏ ਹਨ, ਕਮਰੇ ਦੇ ਤਾਪਮਾਨ 'ਤੇ 1 ਘੰਟੇ ਲਈ 5 ਦੇ MOI 'ਤੇ। ਕੁਝ ਪ੍ਰਯੋਗਾਂ ਵਿੱਚ, ਸੈੱਲਾਂ ਨੂੰ ਲਾਗ ਤੋਂ 30 ਮਿੰਟ ਪਹਿਲਾਂ ਪੀਸੀਈਏ ਜਾਂ ਗੈਰ-ਵਿਸ਼ੇਸ਼ ਐਂਟੀਬਾਡੀ ਈਡੀਡੀਏ ਦੇ 1:4 ਪਤਲੇ ਨਾਲ ਪ੍ਰੀ-ਟਰੀਟ ਕੀਤਾ ਗਿਆ ਸੀ। ਲਾਗ ਤੋਂ ਬਾਅਦ, ਕਲਚਰ ਨੂੰ ਵੱਡੇ ਪੱਧਰ 'ਤੇ ਧੋ ਦਿੱਤਾ ਗਿਆ ਸੀ ਅਤੇ ਵਾਇਰਸ ਦੇ ਨਮੂਨੇ ਦੱਸੇ ਗਏ ਸਮੇਂ 'ਤੇ ਲਏ ਗਏ ਸਨ। ਚਿੱਤਰ 8. HCEA ਗਲਾਈਕੋਪ੍ਰੋਟੀਨ ਨੂੰ ਪ੍ਰਗਟ ਕਰਨ ਵਾਲੇ BHK ਸੈੱਲਾਂ ਵਿੱਚ ਵਾਇਰਸ ਐਂਟੀਜੇਨ। ਚਿੱਤਰ 7 ਲਈ ਵਰਣਨ ਕੀਤੇ ਗਏ ਕਲਚਰ ਫਿਕਸ ਕੀਤੇ ਗਏ ਸਨ ਅਤੇ ਵਾਇਰਲ ਐਂਟੀਜੇਨ ਦੀ ਮੌਜੂਦਗੀ ਲਈ FA ਦਾਗ ਕੀਤੇ ਗਏ ਸਨ। (A) V51B ਨਾਲ ਸੰਕਰਮਿਤ BHK-hCEA ਸੈੱਲ (B) V51B ਨਾਲ ਸੰਕਰਮਿਤ BHK ਸੈੱਲ (C) MHV-A59 ਨਾਲ ਸੰਕਰਮਿਤ BHK-hCEA ਸੈੱਲ (D) MHV-A59 ਨਾਲ ਸੰਕਰਮਿਤ BHK ਸੈੱਲ। ਚਿੱਤਰ 9 . BHK-hCEA ਸੈੱਲਾਂ ਵਿੱਚ ਲਗਾਤਾਰ ਵਾਇਰਸ ਪ੍ਰਤੀਕ੍ਰਿਤੀ। BHK-hCEA ਸੈੱਲਾਂ (10 6 ) ਦੇ ਕਲਚਰ ਕਮਰੇ ਦੇ ਤਾਪਮਾਨ 'ਤੇ 1 ਘੰਟੇ ਲਈ 5 ਦੇ MOI 'ਤੇ MHV-A59, V10B, V30B, V51A, ਅਤੇ V51B ਨਾਲ ਸੰਕਰਮਿਤ ਹੋਏ ਸਨ। ਪਲੇਕ ਅਸੈਸ ਦੁਆਰਾ ਵਿਸ਼ਲੇਸ਼ਣ ਲਈ ਨਿਰਧਾਰਤ ਸਮੇਂ 'ਤੇ ਵਾਇਰਸ ਟਾਇਟਰਾਂ ਦੀ ਕਟਾਈ ਕੀਤੀ ਗਈ ਸੀ।

ਵਿਗਿਆਨੀ ਲੈਬ ਵਾਇਰਸਾਂ ਨੂੰ ਹੋਰ ਛੂਤਕਾਰੀ ਬਣਾਉਣ ਲਈ ਕਿਉਂ ਬਦਲਦੇ ਹਨ

ਮਾਈਕਰੋਬਾਇਓਲੋਜੀ ਟੂਲਬਾਕਸ ਵਿੱਚ ਵਾਇਰਸਾਂ ਵਿੱਚ ਪਰਿਵਰਤਨ ਪੈਦਾ ਕਰਨ ਦੀਆਂ ਤਕਨੀਕਾਂ ਸ਼ਾਮਲ ਹਨ ਜੋ ਰੋਗਾਣੂਆਂ ਨੂੰ ਨਵੀਆਂ ਸ਼ਕਤੀਆਂ ਦਿੰਦੀਆਂ ਹਨ। ਵਿਗਿਆਨੀ ਇਹ ਹੇਰਾਫੇਰੀ ਕਈ ਕਾਰਨਾਂ ਕਰਕੇ ਕਰਦੇ ਹਨ, ਜਿਸ ਵਿੱਚ ਇਹ ਸਮਝਣਾ ਵੀ ਸ਼ਾਮਲ ਹੈ ਕਿ ਰੋਗਾਣੂ ਸਾਡੇ ਇਮਿਊਨ ਸਿਸਟਮ ਦੁਆਰਾ ਖੋਜਣ ਤੋਂ ਕਿਵੇਂ ਬਚਦੇ ਹਨ। ਪਰ ਇੱਕ ਜਰਾਸੀਮ ਵਿੱਚ ਸਮਰੱਥਾ ਨੂੰ ਜੋੜਨ ਨਾਲ ਸਪੱਸ਼ਟ ਜੋਖਮ ਹੁੰਦੇ ਹਨ, ਖਾਸ ਤੌਰ 'ਤੇ ਜੇ ਇਸ &ldquoਗੇਨ ਫੰਕਸ਼ਨ&rdquo ਵਿੱਚ ਵਧੀ ਹੋਈ ਵਾਇਰਲੈਂਸ ਜਾਂ ਛੂਤਕਾਰੀ ਸ਼ਾਮਲ ਹੁੰਦੀ ਹੈ। ਦੁਰਘਟਨਾ ਜਾਂ ਡਿਜ਼ਾਈਨ ਦੁਆਰਾ, ਲੈਬ ਤੋਂ ਬਚਣਾ ਇੱਕ ਸੰਭਾਵਨਾ ਹੈ। ਤਾਂ ਇਸ ਨੂੰ ਕਿਉਂ ਕਰੀਏ? ਕੁਝ ਖੋਜਕਰਤਾਵਾਂ ਦਾ ਕਹਿਣਾ ਹੈ ਕਿ ਇਹ ਕੰਮ ਇਸ ਗੱਲ 'ਤੇ ਝਾਤ ਮਾਰ ਸਕਦਾ ਹੈ ਕਿ ਵਾਇਰਸ ਕੁਦਰਤੀ ਸੰਸਾਰ ਵਿੱਚ ਜਾਣ ਤੋਂ ਪਹਿਲਾਂ ਕੀ ਕਰ ਸਕਦਾ ਹੈ ਅਤੇ ਲੋਕਾਂ ਲਈ ਖ਼ਤਰਾ ਪੈਦਾ ਕਰਦਾ ਹੈ।

2014 ਵਿੱਚ ਲਾਭ-ਆਫ-ਫੰਕਸ਼ਨ ਖੋਜ ਨੂੰ ਲੈ ਕੇ ਵਿਵਾਦ ਨੇ ਅਕਾਦਮਿਕ ਪੇਪਰਾਂ, ਕਾਨਫਰੰਸਾਂ ਅਤੇ ਇੱਥੋਂ ਤੱਕ ਕਿ ਇੱਕ ਮੁਅੱਤਲ ਵੀ ਪੈਦਾ ਕੀਤਾ ਹੈ, ਜਦੋਂ ਅਮਰੀਕੀ ਸਰਕਾਰ ਨੇ ਪ੍ਰਕਿਰਿਆ ਦੀ ਸੁਰੱਖਿਆ ਨੂੰ ਯਕੀਨੀ ਬਣਾਉਣ ਲਈ ਕਦਮ ਚੁੱਕੇ ਜਾਣ ਤੱਕ ਤਿੰਨ ਸਾਲਾਂ ਲਈ ਫੰਡਿੰਗ ਨੂੰ ਰੋਕ ਦਿੱਤਾ ਸੀ। ਮਹਾਮਾਰੀ ਦੇ ਬਾਅਦ ਦੇ ਪੜਾਵਾਂ ਵਿੱਚ ਲਾਭ-ਆਫ-ਫੰਕਸ਼ਨ ਪ੍ਰਯੋਗਾਂ ਬਾਰੇ ਬਹਿਸ ਜਾਰੀ ਰਹਿੰਦੀ ਹੈ ਕਿਉਂਕਿ ਵਿਚਾਰ COVID-19 ਲਈ &ldquonext one&rdquo ਜਾਂ ਸੰਭਾਵਿਤ ਦੂਜੇ ਐਕਟ ਵੱਲ ਮੁੜਦੇ ਹਨ। Science policy makers must wrestle with defining the rare instances in which the benefits of experiments that enhance a virus&rsquos capacity to survive and flourish in human hosts outweigh any risks.

Densely technical discussions often bog down over the very definition of gain of function. Recently, semantics were front and center in the debate over whether National Institutes of Health&ndashfunded work at the Wuhan Institute of Virology (WIV) in China constituted gain-of-function research, a contention denied by the U.S. agency. The WIV has also been the focus of a revived dispute over whether SARS-CoV-2, the virus that causes COVID-19, escaped from its facility.

Here are a few basic answers to questions about why an obscure technical term now receives so much attention.

What is gain of function research?

Techniques to enhance some aspect of an organism&rsquos functioning are commonplace in research and applied to everything from mice to measles. One typical application of this approach is tweaking mouse genes to generate more of a protein that limits fat deposition.

But that is not the kind of gain-of-function study that raises fears among scientists and regulators. The high-risk practices are those that create mutations to examine whether a pathogen becomes more contagious or lethal as a means of estimating future threats.

Some experts acknowledge the critical differences between the two types of studies. One proposed term to represent the more threatening subset of this research is &ldquopotential pandemic pathogens,&rdquo says Marc Lipsitch, a professor of epidemiology at the Harvard T. H. Chan School of Public Health. That phrase &ldquosingles out the name and reason for being concerned,&rdquo he adds. It has not caught on in common usage, however, returning only about 8,500 results in a Google search, compared with 13.4 million for &ldquogain of function.&rdquo

Making this distinction is important for a few reasons, Lipsitch says. When the U.S. government placed the 2014 moratorium on &ldquogain of function research,&rdquo some of the studies that were affected carried no obvious risk of setting off a pandemic.

What is the purpose of this research?

Knowing what makes a microbe more dangerous enables preparation of countermeasures, says Lipsitch, who is one of 18 signatories to a May 14 letter, published in ਵਿਗਿਆਨ, that calls for the investigation of a SARS-CoV-2 lab spillover as one of several possible explanations for the origins of the COVID-19 pandemic. He points to the difficulties of studying viruses for the development of vaccines and treatments without doing experiments in a mouse or in other nonhuman animals. There is, Lipsitch says, a &ldquodirect path from doing that research to gaining public health benefits,&rdquo enabling a balancing of risks and potential benefits.

The riskier version of gain-of-function research creates viruses with abilities they do not have in nature. In two separate studies in 2011, scientists famously and controversially did just that with the H5N1 influenza virus, or &ldquobird flu,&rdquo resulting in a version capable of airborne transmission among ferrets. The naturally occurring virus does not have this ability. Making mammal-to-mammal transmission easier set off alarm bells and triggered discussion of a U.S. moratorium.

In 2015 researchers engineered a hybrid pathogen that combined features of the original SARS virus (SARS-CoV) that infected humans in the early 2000s with that of a bat coronavirus. Most bat coronaviruses cannot infect the cells lining the human respiratory tract. This experiment was intended to mimic what would happen if a third species served as a mixing vat for the bat and human viruses to exchange genetic material. The result was a pathogen that could enter human cells and also cause disease in mice. Reactions to this work were polarized, as demonstrated by experts quoted in a 2015 article in ਕੁਦਰਤ: one said that all the research did was create a &ldquonew, non-natural risk&rdquo among the multitude that already exist, while another contended that it showed the potential for this bat virus to become a &ldquoclear and present danger.&rdquo

Experts in the latter camp argue that gain-of-function virus studies can presage what will eventually happen in nature. Speeding things up in the lab gives researchers firsthand evidence about how a virus might evolve. Such insights could drive predictions about future viral behaviors in order to stay a step ahead of these pathogens.

That calculation must be made on a case-by-case basis, Lipsitch says. &ldquoThere is not one-answer-fits-all,&rdquo he adds. But the key question to address in this complex computation is &ldquoIs this work so valuable for public health that it outshines the risk to public health in doing it?&rdquo

Lipsitch was &ldquovery outspoken,&rdquo as he puts it, about the influenza-ferret study, and he led the effort for the 2014 moratorium on similar gain-of-function work. &ldquoI did that because I thought that we need to have a real accounting of the benefits and risks,&rdquo he says. &ldquoI had a view that the benefits were very small, and I still have that view.&rdquo

The moratorium was lifted in 2017. A U.S. government review panel later approved a resumption of funding for more lab studies involving gain-of-function modifications of bird flu viruses in ferrets. Conditions of the approvals, according to reports, included enhanced safety measures and reporting requirements.

As for SARS-CoV-2, the virus of most urgent interest right now, the NIH released a statement on May 19 that neither the agency nor its National Institute of Allergy and Infectious Diseases has &ldquoever approved any grant that would have supported &lsquogain-of-function&rsquo research on coronaviruses that would have increased their transmissibility or lethality for humans.&rdquo

What are the risks?

Predictions based on gain-of-function studies may be hypothetical, but lab breaches in the U.S. are not. Serious violations are uncommon and have almost never resulted in a pathogen being released into the community. But 2014 showed why human error may prove to be the biggest wild card in planning these experiments.

Several lab accidents that year endangered researchers and set off waves of uneasiness. These incidents were not gain-of-function mishaps, but they demonstrated the potential threats posed by a biosafety lab&mdashwhether from negligence or malfeasance. In 2014 about 75 Atlanta-based employees at the U.S. Centers for Disease Control and Prevention learned about their potential exposure to anthrax after safety practices were ignored. Also, several long-forgotten vials of freeze-dried smallpox&mdasha pathogen long thought to be stored in only two places, one in Russia and one in the U.S.&mdashturned up during a cold-storage cleanup at the NIH that year. And the CDC made news again a month later, after it sent out vials of a relatively benign influenza virus contaminated with the much more deadly H5N1 avian flu virus. The possible reason, as reported in ਵਿਗਿਆਨ, was that a researcher was &ldquooverworked and rushing to make a lab meeting.&rdquo

Michael Imperiale, a professor of microbiology and immunology and associate vice president for research and compliance at the University of Michigan, co-authored a 2020 editorial about gain-of-function studies that said that the key to planning them is to have proper mechanisms to ward off the threats of accidental or intentional harm. &ldquoIf proper biosafety procedures are in place and proper containment is used, the risks can be mitigated substantially,&rdquo he says. Biosafety level 4 (BSL-4) labs have the highest containment precautions in place, and the U.S. currently has 13 or more such facilities planned or in operation. Research on the novel coronavirus is handled in labs one notch down: BSL-3.

In their editorial, Imperiale and his co-author Arturo Casadevall, editor in chief of mBIO, wrote that even predicting the threat level of an accidental release is difficult. After publication of the studies of ferret-to-ferret transmission of engineered H5N1, two groups tried to predict what would have happened if this virus had escaped into the human population. One team, Imperiale and Casadevall wrote, predicted an &ldquoextremely high level&rdquo of transmission. The other, from one of the labs involved in the ferret-influenza work, concluded otherwise.

In the context of the COVID-19 pandemic, the authors of the editorial wrote, the source of a pathogen&mdashwhether from nature or a lab&mdashdoes not change how the world should prepare to respond to it. But gain-of-function experiments should be governed by transparency in planning the research, a &ldquorededication&rdquo to biosafety and a strong surveillance program to capture breaches.

What alternative techniques are available to test a potential viral threat?

If a virus has already moved from an animal host to humans, gain-of-function research may be unnecessary, Imperiale says. &ldquoIn these cases, there may be animal models that serve as useful surrogates for humans&rdquo in testing the virus&rsquos effects, he says.

Researchers can also test the capacity of virus proteins to engage with different kinds of cells. Software can predict how these proteins might interact with various cell types or how their genetic sequences could be associated with specific virus features. Also, if the researchers use cells in a lab dish, the viruses might be designed not to replicate.

Another option is loss-of-function research. Using versions of a virus with less pathogenic potential is another way to unlock that microbe&rsquos secrets. Still, highly pathogenic forms can be quite different from their less threatening counterparts&mdashfor example, they may differ in how often they replicate&mdashpossibly limiting the usefulness of such studies.


2 thoughts on &ldquoCross-Species Transmission in Rabies&rdquo

This was a really cool and informative post which clarified a lot of questions I had about CST. The fact that “the majority of viruses from cross-species infections were tightly nested among genetically similar bat species” paired with the statistics given makes me wonder how close human and bat defense systems really are.

Interesting study, though it might be overstepping its bounds in generalization. While this may have worked with bats infecting bats, I doubt that transmission between more dissimilar species, such as bats, pigs, or birds to humans, will factor host similarity to such a degree. For this reason, viral mutation still seems like the most plausible reason for cross-species transmission, though this finding may be much more applicable when applied to CST between more similar species, such as in this case.